Datasets:

SkyWhal3
/

stxbp1-pubmed-central-fulltext

pmc_id stringlengths 8 11	title stringlengths 0 624	abstract stringlengths 0 7.73k	main_text stringlengths 0 8.7M	authors listlengths 0 100	journal stringlengths 3 168	doi stringlengths 0 47	pmid stringlengths 0 8	num_figures int64 0 1.11k	num_images int64 0 1.11k	abstract_length int64 0 7.73k	main_text_length int64 0 8.7M
PMC10000387	Implementation of Exome Sequencing in Prenatal Diagnostics: Chances and Challenges	Whole exome sequencing (WES) has become part of the postnatal diagnostic work-up of both pediatric and adult patients with a range of disorders. In the last years, WES is slowly being implemented in the prenatal setting as well, although some hurdles remain, such as quantity and quality of input material, minimizing turn-around times, and ensuring consistent interpretation and reporting of variants. We present the results of 1 year of prenatal WES in a single genetic center. Twenty-eight fetus-parent trios were analyzed, of which seven (25%) showed a pathogenic or likely pathogenic variant that explained the fetal phenotype. Autosomal recessive (4), de novo (2) and dominantly inherited (1) mutations were detected. Prenatal rapid WES allows for a timely decision-making in the current pregnancy, adequate counseling with the possibility of preimplantation or prenatal genetic testing in future pregnancies and screening of the extended family. With a diagnostic yield in selected cases of 25% and a turn-around time under 4 weeks, rapid WES shows promise for becoming part of pregnancy care in fetuses with ultrasound anomalies in whom chromosomal microarray did not uncover the cause. Keywords:prenatal diagnosis, whole exome sequencing, chromosomal microarray, diagnostic yield, congenital anomalies	## 1. Introduction Major congenital anomalies (MCA) have a prevalence of 2–3% and are responsible for a significant percentage of pre- and perinatal demise and neonatal morbidity [1,2]. The etiology is heterogeneous, ranging from prenatal infections over teratologic agents to genetic causes. Chromosomal microarray analysis (CMA) has been widely implemented in the analysis of invasively obtained prenatal samples (amniotic fluid or chorion villi) for the genome-wide detection of both aneuploidies and microdeletions/microduplications (copy number variants or CNVs). In up to 40% of pregnancies with a fetal structural anomaly, CMA is able to diagnose an aneuploidy or CNV [3], still leaving more than half of the cases undiagnosed. Several recent metaanalyses have demonstrated an added diagnostic yield of 1.8–68% for prenatal whole exome sequencing (WES), with the yield largely depending on the inclusion criteria and organ system affected [4,5,6,7,8]. With increasing evidence of the relevance of WES in the prenatal context, revision of the guidelines of the International Society for Prenatal Diagnosis (ISPD) offers directions on how to implement it [9]. This paper describes the experiences of a single Belgian genetic center with the implementation of WES in the prenatal diagnostic workflow. In Belgium, the molecular analysis of publicly funded invasive prenatal diagnosis can only be executed at one of the eight Centers for Medical Genetics. For all indications, a genome-wide microarray is performed with national consensus guidelines in place steering the interpretation and reporting of the results [10]. Recently, a national framework has been formulated guiding the indication, analysis and reporting of prenatal WES. Here we discuss the opportunities and challenges for the use of WES in the diagnosis of fetuses with ultrasound abnormalities and provide suggestions for implementation of this valuable technique in other labs. ## 2. Methods Genomic DNA was extracted from either amniotic fluid, chorion villi or cultured amniocytes using the Maxwell RSC Blood DNA kit on a Maxwell RSC 48 Instrument (Promega, Madison, MI, USA). Library prep on 50ng of genomic DNA was performed using the Twist Human Core Exome kit (Twist Bioscience, South San Francisco, CA, USA) according to the manufacturer’s instructions on a Hamilton STAR robot (Hamilton, Bonaduz, Switzerland). Twenty-four libraries were pooled equimolarly for sequencing on a NextSeq500 or NextSeq550 instrument with a 2 × 75 bp or 2 × 150 bp flow cell (Illumina, San Diego, CA, USA). WES data were analyzed using an in-house developed pipeline which considers only de novo, X-linked and recessive variants, either in a predefined panel (e.g., in case of a skeletal dysplasia) or exome-wide [11]. Additionally, the AI-driven decision-support software Moon was applied to complement our pipeline with an independent phenotype-driven analysis (Invitae, San Francisco, CA, USA), allowing the identification of variants outside the panel (if applied) and of inherited variants. An independent analysis was performed to detect sample swaps and to verify the family relations within each trio. The guidelines for prenatal WES were developed at a national level and can be found at the website of the Belgian College of Genetics (www.college-genetics.be(accessed on 1 December 2022)). The following criteria must be met: (1) The fetus shows ultrasound anomalies, but CMA is negative; a diagnosis is essential to guide the pregnancy/neonatal management; (2) All cases should be reviewed in a multidisciplinary team including a clinical geneticist; (3) Expert fetal ultrasound examinations are required to provide the best possible phenotypic evaluation. When beneficial, fetal MRI may be performed; (4) Pretest counseling by a clinical geneticist is mandatory, with signed informed consent by both parents; (5) Trio analysis (simultaneous analysis of the fetus and both parents) is strongly recommended to speed up the process. Variant classification is performed based on the ACMG guidelines [12]. Only pathogenic (class V) and likely pathogenic (class IV) variants with known effect on gene function and which fit with the fetal phenotype and the inheritance mode are communicated. Variants of uncertain significance (class III) are in principle not communicated, but exceptions can be made for variants in known disease genes that (a) fit the fetal phenotype, (b) are expected to show the same pathomechanism as known pathogenic variants and (c) arose as de novo events or are detectedin transwith a pathogenic or likely pathogenic variant and for which further clinical exams (ultrasound, MRI, etc.) are recommended to refine variant classification, possibly leading to a genetic diagnosis (upgrade of the variant to class IV/V). By national agreement, no systematic search for secondary findings, unrelated to the fetal phenotype, is performed, in line with the framework proposed by Vears et al. [13] The identification of incidental findings is minimized by optimizing the filter settings without jeopardizing the detection of primary results. In this category, de novo fetal highly penetrant class IV/V variants known to cause moderate or severe childhood-onset disorders are reported, as well as inherited class IV/V variants causing late-onset disorders for which reporting can be expected to cause an undeniable health benefit, such as those listed in the ACMG SF v3.0 list [14]. Fetal (and maternal) carriership for X-linked recessive disorders will be reported as well, as it can be of relevance for future pregnancies of both mother and child. On the other hand, variants causing late onset disease without actionability and carriership for autosomal recessive disorders will not be communicated. The turn-around-time (TAT) was nationally set at eight weeks for ongoing pregnancies. ## 3. Results The Center of Medical Genetics Antwerp, which is one of the eight genetic centers in Belgium, processes about 400 invasive prenatal samples on a yearly basis. In our center, the routine approach to determine the genetic etiology in case of fetal ultrasound anomalies, regardless of the gestational age, follows a sequential approach: first, we perform a quantitative fluorescent PCR (QF-PCR) for exclusion of the common aneuploidies (trisomy 13, 18, 21, sex chromosomal aneuploidies) and triploidy as well as for determination of maternal cell contamination and fetal identity through comparison to the maternal profile. Next, CNV detection by CMA is performed, more precisely a SNP (single nucleotide polymorphism) array with a 400 kb resolution. However, this combined approach yields a diagnosis in less than 25% of cases: on 3453 analyses that were performed over the past nine years, QF-PCR and SNP array were positive in 786 cases (22.8%), among which 557 with a trisomy (70.9% of positive and 16.1% of total cases), 30 with a triploidy (respectively 3.8% and 0.87% of cases), 62 with monosomy X (respectively 7.9% and 1.8% of cases) and 134 with a subchromosomal pathogenic anomaly (respectively 17% and 3.9% of cases) (Figure 1). [diagnostics-13-00860-f001] Since January 2021, our center offers the subsequent option of whole exome sequencing (WES). In 2021, WES was performed in our center on 28 prenatal cases showing structural anomalies on ultrasound (seeFigure 2andSupplementary Table S1). Twenty WES analyses were performed on DNA extracted from uncultured amniotic cells, six from cultured amniotic cells and two from chorion villi. In all but two cases, an ‘open’ WES was performed, as the ultrasound anomalies did not allow the selection of a predefined gene panel; for the two remaining cases, the analysis was restricted to our skeletal dysplasia gene panel of 436 genes (seeSupplementary Table S2for the composition of the panel). All cases passed our quality score (capture of more than 95% of the exome with at least 20× coverage). Pathogenic or likely pathogenic variants were identified in seven out of 28 (25%) cases: two de novo variants, four autosomal recessive and one paternally inherited (from an affected parent) (seeTable 1). In three fetuses with skeletal anomalies, WES detected respectively a dominantly inheritedCOL2A1variant (seeFigure 3), a homozygousFANCGvariant and a de novoKMT2Dvariant. The fetus with theCOL2A1variant displayed rhizomelic shortening and bowing of the long bones, microretrognathia and clenched hands-on prenatal ultrasound. The fetus with theFANCGvariant came to attention through intrauterine growth restriction (IUGR), thumb hypoplasia on the left hand and absent thumb on the right hand. The fetus with theKMT2Dvariant had talipes equinovarus as well as abnormal placing of the ears. [diagnostics-13-00860-f002] ### Table 1. [diagnostics-13-00860-f003] Three fetuses with multisystem anomalies, defined as the presence of at least two major anomalies in different anatomical systems, carried respectively a homozygousMUSKvariant (seeFigure 4), a homozygousCHRNA1variant and compound heterozygousTHOC6variants. The pregnancy with theMUSKvariant was suspicious since it was the second pregnancy of this couple with fetal hydrops. The first was terminated and no genetic analyses had been performed; in the current, the evolution towards a more severe phenotype with fetal akineseia and abnormal position of the lower limbs justified exome sequencing. The fetus with theCHRNA1variant came to attention because of multiple congenital malformations, namely retrognathia, diffuse subcutaneous edema, increased nuchal fold, clenched fingers, bell-shaped thorax and bilateral rocker bottom feet. The fetus with theTHOC6variants displayed Tetralogy of Fallot, cerebellar hypoplasia, mild ventriculomegaly and hypospadias. The last positive case was a de novoRIT1variant in a fetus with bilateral hydrothorax, ascites, generalized subcutaneous edema and polyhydramnion. All but one variant was classified as pathogenic; the missense variant inCHRNA1was classified as likely pathogenic as it had not been described in the literature, but was deemed pathogenic by prediction scores and fit the phenotype. Additionally, a pathogenic incidental finding inSTXBP1was reported in one case that also carried a pathogenic variant which explained the phenotype (RIT1). In all but one case, the parents opted for a termination of the pregnancy (seeTable 1). The exception was the fetus with the paternally inheritedCOL2A1variant. At birth, the baby showed—in addition to the prenatally observed anomalies—cleft palate, atrial septal defect, pathological auditory evoked potentials and ophtalmological abnormalities compatible with Stickler syndrome. At 4 months, her length is at P10 and some additional facial dysmorphisms, such as narrow palpebral fissures, long philtrum, thin upper lip and full cheeks, become apparent. [diagnostics-13-00860-f004] When grouped based on the organ system(s) involved (see also Mellis et al. 2022 [4]), the highest diagnostic yield was obtained in case of skeletal anomalies (three out of six cases or 50%) or multisystem anomalies (three out of eight cases or 37.5%). No diagnosis was found in seven cases with heart disease and five with a central nervous system anomaly (Figure 2). ## 4. Discussion In Belgium, prenatal WES in a diagnostic setting is publicly funded and fully reimbursed. National guidelines describing the inclusion criteria, pre- and posttest counseling and the filtering and reporting strategy have been developed by a committee of laboratory and clinical geneticists and are publicly available on the website of the Belgian College for Human Genetics and Rare Diseases (www.college-genetics.be(accessed on 1 December 2022)). However, prenatal WES has not been implemented widely, as many hurdles still remain. Issues involve (1) the quality and quantity of the starting material; (2) the short TAT; (3) the interpretation of variants; (4) the ethical perspective. In our center, no problems with DNA quality were encountered—for all samples, DNA was extracted in-house according to an accredited protocol that yields high quality DNA. For some of the samples, insufficient DNA was obtained upon extraction from uncultured amniocytes and a second DNA extraction from cultured amniocytes was required. As a precaution, we always culture part of the amniocytes. First, this provides a back-up source of DNA, although we need as little as 2 ng of starting material for QF-PCR, 20 ng for SNP array and 50 ng for WES. Second, during the culturing process, growth of amniocytes is enhanced, but that of peripheral blood cells is not, which is an advantage in case the QF-PCR on the DNA extracted from the uncultured amniocytes shows maternal cell contamination [15]. Although the TAT for prenatal WES has been set nationally at eight weeks, we lowered it to 4 weeks, allowing timely decision-making for the ongoing pregnancy; couples might either consider termination of pregnancy when a genetic diagnosis is established or the etiology could guide the obstetric and neonatal management. Both the library prep and the sequencing run are performed biweekly; analysis and interpretation take maximally 1 additional week, including multidisciplinary discussions on variant interpretation or reporting. All cases were analyzed as trio (index and both parents), which allows filtering of de novo, autosomal recessive and X linked variants. Additionally, we use a phenotype-driven software package for variant prioritization (Moon, Invitae) to detect inherited variants that fit the phenotype (e.g., in imprinted genes or with a mosaic or presumably unaffected carrier parent) and, in case of panel-based analysis, variants in genes outside the panel. Apart from trio analysis, other steps to limit the number of variants that require classification are minor allele frequency in the GnomAD database and our own database, location (only exonic variants and variants in the splice regions are considered) and allelic ratio of the mutant versus wild-type allele. Extensive phenotyping is key to interpretation of the remaining variants. In our center, we developed a database where clinicians can enter the phenotype as HPO (Human Phenotype Ontology) terms, allowing for structured phenotyping. Correlating the genotype with the prenatal phenotype was challenging. In general, the fetal phenotype of many conditions has not been well described and may deviate quite substantially from the known postnatal phenotype. Cataloguing the phenotype of prenatal-onset syndromes is of utmost importance to guide healthcare providers in recognizing these syndromes at an early stage and know their evolution throughout the pregnancy [16,17]. The correlation was the most obvious in the fetus with theRIT1mutation (case 23), associated with Noonan type 8 (OMIM# 615355): hydrops, ascites and hydrothorax, which were all present in this fetus, are frequent ultrasound markers in RASopathies. Given the genotypic heterogeneity of Noonan syndrome and by extension non-immune hydrops fetalis [18], WES or whole-genome sequencing are powerful diagnostic tools for these diseases [19]. This fetus also carried a de novo pathogenic variant inSTXBP1, that was reported as incidental finding because of its association with developmental and epileptic encephalopathy 4 (OMIM# 612164). Given the severe phenotype of seizures, profoundly impaired psychomotor development, limited or absent ability to walk, spastic quadriplegia and poor or absent speech, prenatal testing in a future pregancy is warranted as parental gonadal mosaicism cannot be ruled out. In case of a suspicion of a fetal skeletal dysplasia, the value of adding WES to the prenatal diagnostic tools has been demonstrated before [20,21,22]; this was confirmed in our cohort, with three out of six cases (50%) being solved by WES. The fetus with Stickler syndrome type I (OMIM# 108300) caused by a heterozygousCOL2A1missense mutation (case 10) displayed rhizomelic shortening and bowing of the long bones as well as microretrognathia and clenched hands on ultrasound (Figure 3a,b). The mutation was paternally inherited, manifesting in the to that point undiagnosed father with severe myopia, hearing disorder, short stature, retrognathia, a nasal voice, tibia bowing, platyspondyly, coxofemoral dysplasia, hyperlordosis and rhizomelic shortening of the long bones (Figure 3c–e). Analysis of the paternal grandparents demonstrated that the mutation arose de novo in the father. The second fetus with skeletal anomalies (case 1) was diagnosed with Kabuki syndrome as a result of a de novo stop mutation inKMT2D(OMIM# 147920). Kabuki syndrome shows prenatal phenotypic heterogeneity, with ultrasound abnormalities that are non-specific. The most frequent ultrasound features include cardiac anomalies (49.4%), followed by polyhydramnios (28.9%), genitourinary anomalies (26.5%), single umbilical artery (15.7%), intrauterine growth restriction (14.5%) and hydrops fetalis/pleural effusion/ascites (12.0%) [23]. The fetus in our cohort showed only bilateral talipes equinovarus and abnormal ears, illustrating the broad fetal phenotypic heterogeneity. The third fetus (case 8) presented with intrauterine growth restriction, oligodactyly of the left hand and a hypoplastic ray of the right hand and was diagnosed with Fanconi anemia (FA) due to a homozygousFANCGnonsense variant (OMIM# 614082). FA is an autosomal recessive disorder with both phenotypic and genotypic heterogeneity, but major birth defects such as skeletal malformations (mainly uni- or bilateral radial ray anomalies), microcephaly, genitourinary malformations and intrauterine growth restriction are present in 75% of the cases. Consequently, these findings in the prenatal setting are suggestive of FA, although absence of skeletal anomalies does not exclude FA [24]. Radial ray defects, as present in this fetus, can be associated with various disorders, but in combination with IUGR or other MCA, it is indicative of FA [25,26]. Rapid WES in case of skeletal anomalies allows differentiating between isolated and syndromic forms, which is key to counseling the parents. Of eight fetuses with multisystem aberrations in our series, three (37.5%) were positive. The first (case 26) was compound heterozygous for four known missense variants (of which three on the maternal allele that have been described as a pathogenic haplotype) inTHOC6, causing Beaulieu-Boycott-Innes syndrome (OMIM# 613680). There are seven reports of prenatally diagnosed Beaulieu-Boycott-Innes syndrome with variable clinical findings, such as IUGR, cerebral malformations, genito-renal abnormalities, cystic hygroma, retrognathia and suspicion of ventricular septal defect [27]. Our case showed olivopontocerebellar hypoplasia, tetralogy of Fallot and hypospadias on ultrasound. The second fetus (case 28) was diagnosed with a homozygous missense variant in a receptor tyrosine kinase (MUSK). For fetal akinesia deformation sequence 1 (FADS1), caused by homozygousMUSKmutations (OMIM# 208150), prenatal diagnosis is based on multiple contractures, reduced motility, flattening of facial profile and—with increasing gestational age—IUGR, reduced cardiothoracic ratio and polyhydramnios [28]. The ultrasound features present in our case (hydrops, hydrothorax, ascites, fetal akinesia, hypotonia, rocker-bottom feet;Figure 4) fit the described prenatal phenotype. The third fetus (case 12) presented with nuchal translucency, edema, rocker-bottom feet, aberrant chest and ribs and retrognathia and was diagnosed with a homozygousCHRNA1missense variant. Recessive mutations in theCHRNA1gene result in lethal multiple pterygium syndrome (LMPS; OMIM# 253290). LMPS displays a heterogeneous range of prenatal manifestations that generally include cystic hygroma, pulmonary hypoplasia, cleft palate, cryptorchidism, joint contractures, fetal akinesia, heart defects, growth restriction and intestinal malrotation [29]. In retrospect, the phenotype of this fetus fits the LMPS syndrome, but a clinical diagnosis remains challenging in the prenatal stage. In total, WES was able to pinpoint the cause of the fetal anomalies in 25% of cases (7 out of 28). Among the seven positive cases, two were de novo, four recessive and one paternally inherited (from an affected parent). Multidisciplinary genetic counseling of the prenatal results was performed and except for the parents with the fetus diagnosed with paternally inherited Stickler syndrome, all chose to terminate the pregnancy after approval by the ethical committee of the University Hospital Antwerp. For all cases, the decision to terminate was based on the WES result, effectively demonstrating its use in the prenatal setting. For five out of seven families (71.4%), the recurrence risk is high and preimplantation or prenatal invasive genetic testing can be offered in future pregnancies. For the family with the dominantly inherited variant, testing in first-degree relatives of the father can be considered as well. In the families with a de novo variant, genetic testing in future pregnancies should be discussed because of the possibility of parental gonadal mosaicism. Ethically, the most demanding issue is the possibility of incidental findings in both fetus and parents. Although rigorous filtering can reduce the number of incidental findings, they can never be fully excluded as this would jeopardize the identification of the primary variant(s) explaining the phenotype. Therefore, a genetic pretest counseling as well as informed consent by both parents are mandatory, so that they are well aware of the possible outcomes. The only incidental finding we encountered was a de novo mutation inSTXBP1, associated with developmental and epileptic encephalopathy type 4, in the fetus carrying theRIT1mutation. In case of future prenatal invasive testing, presence of both theRIT1and theSTXBP1mutation can be evaluated. The recent update of the ISPD position statement on prenatal WES states that although the available data is insufficient to recommend which categories of abnormalities warrant sequencing, there are ‘sufficient data to begin differentiating diagnostic yields by specific organ system or number of organ systems affected’ [9]. Our results confirm their findings that prenatal WES holds great promise for pregnancies with skeletal or multisystem anomalies. In our hands, prenatal WES was less successful in foetuses with cardiac and CNS abnormalities, but the number of cases in this study is too low to draw any definitive conclusions. It can be expected that, based on the contribution of this and other manuscripts describing the results of WES in the prenatal context, uniform guidelines on the indications for which to consider WES will follow in the near future. ## 5. Conclusions Our data set, although limited, clearly shows the added value of WES in the prenatal setting in case of MCA. The diagnostic yield of 25% demonstrates that the rigorous selection of prenatal cases according to our national guidelines is effective; yield is highest in cases with skeletal or multisystem anomalies. Furthermore, our findings demonstrate that WES can be implemented in a medium-throughput diagnostic lab with little failures and an acceptable TAT, effectively expanding the diagnostic portfolio that can be offered to future parents. ## Acknowledgments The authors wish to thank the patients for their willingness to participate in this study. ## Supplementary Materials The following supporting information can be downloaded athttps://www.mdpi.com/article/10.3390/diagnostics13050860/s1: Table S1: Fetal phenotype and genotype; Table S2: Composition of the skeletal dysplasia gene panel. Legend to Supplementary Table S1; This table contains the 28 fetal cases on whom WES was performed. For each case, the fetal phenotype and the organ system involved are described, as well as the sample type from which the DNA was extracted, the applied gene panel and the result. For the positive cases, the gestational age at ultrasound, the affected gene and variant, the inheritance mode, the associated syndrome, the fetal phenotype as described in the literature and the outcome of the pregnancy are listed as well. AC: amniocytes: AD: autosomal dominant; AR: autosomal recessive; CNS: central nervous system; CV: chorionic villi; hom: homozygous; IF: incidental finding; IUGR: intrauterine growth restriction; LB: live birth; mat: maternal; NT: nuchal translucency; pat: paternal; path: pathogenic; TOP: termination of pregnancy; US: ultrasound; VSD: ventricular septal defect; WES: whole exome sequencing; WESSD: WES with skeletal dysplasia panel; Legend to Supplementary Table S2. This table lists the genes included in the skeletal dysplasias gene panel, that was used for analysis of cases 6 and 10. ## Author Contributions Lab work and interpretation of WES data, N.B. and K.J.; conceptualization, methodology, writing—original draft preparation, writing—review and editing, E.J., M.D.R., B.B. and K.J.; data curation, E.J., M.D.R., C.M., B.B. and K.J.; visualization, E.J. All authors have read and agreed to the published version of the manuscript. ## Institutional Review Board Statement Ethical approval for retrospective studies is not required by the responsible ERC. ## Informed Consent Statement Written and signed informed consent was obtained from the participating patients/their legal guardian and are stored in their medical files. ## Data Availability Statement All data are archived in the patient files. ## Conflicts of Interest The authors declare no conflict of interest. ## Funding Statement This research received no external funding. ## Footnotes ## References ## Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. ### Supplementary Materials ### Data Availability Statement All data are archived in the patient files.	[ "Ewa Janicki", "Marjan De Rademaeker", "Colombine Meunier", "Nele Boeckx", "Bettina Blaumeiser", "Katrien Janssens" ]	Diagnostics	10.3390/diagnostics13050860	36900003	4	4	1,310	26,018
PMC10001118	Epigenetics in LMNA-Related Cardiomyopathy	Mutations in the gene for lamin A/C(LMNA)cause a diverse range of diseases known as laminopathies.LMNA-related cardiomyopathy is a common inherited heart disease and is highly penetrant with a poor prognosis. In the past years, numerous investigations using mouse models, stem cell technologies, and patient samples have characterized the phenotypic diversity caused by specificLMNAvariants and contributed to understanding the molecular mechanisms underlying the pathogenesis of heart disease. As a component of the nuclear envelope,LMNAregulates nuclear mechanostability and function, chromatin organization, and gene transcription. This review will focus on the different cardiomyopathies caused byLMNAmutations, address the role ofLMNAin chromatin organization and gene regulation, and discuss how these processes go awry in heart disease. Keywords:nuclear lamina, lamin A/C,LMNA, cardiomyopathy, epigenetics, chromatin architecture, stem cells	## 1. Introduction Mutations in genes encoding proteins of the nuclear lamina result in wide-ranging clinical phenotypes collectively referred to as laminopathies [1]. Many of these diseases are caused by mutations in the gene for lamin A/C (LMNA) and affect primarily the muscles, the peripheral nerves, and the adipose tissue or cause systemic diseases such as premature aging syndromes [2]. TheLMNAgene encodes A-type lamins, generated by alternative splicing, of which lamins A and C are the main splicing products [3,4]. In addition to the A-type lamins, the nuclear lamina is composed of B-type lamins, i.e., lamins B1 and B2, encoded byLMNB1andLMNB2genes, respectively [5,6,7,8].LMNB2also encodes the germ-line-specific lamin B3, produced by alternative splicing [9]. A- and B-type lamins have a common structural organization: a short “head” domain at the N-terminus followed by a central helical rod domain and a C-terminal “tail” domain. The central rod domain is composed of four coiled-coil regions that allow lamins to form parallel coiled-coil dimers and higher-order meshworks [10,11,12]. The “tail” consists of a globular region, which adopts an immunoglobulin (Ig)-like β-fold involved in protein–protein interactions. Pre-lamin A- and B-type lamins also have a CaaX motif at the C-terminus which guides protein farnesylation and carboxyl methylation, important for targeting to the nuclear envelope [10,11,12] (Figure 1). [cells-12-00783-f001] Both A- and B-type lamins form separate but interconnected filamentous meshworks located between the inner nuclear membrane and the peripheral heterochromatin, which on the one hand provide structural support to the nucleus and on the other hand anchor chromatin at the nuclear periphery, thereby shaping the higher-order chromatin structure [13,14,15]. In contrast to lamins B1 and B2, which are localized at the periphery and associate mainly with transcriptionally inactive chromatin [16,17], lamins A and C are also found in the nuclear interior and associate with both heterochromatin and euchromatin [18]. In addition, lamins interact with the LINC complex, which couples the nucleoskeleton with the cytoskeleton [19,20], and thereby can directly translate mechanical cues and changes in extracellular matrix mechanics into alterations in chromatin structure and transcriptional activity [21]. In the last years, a large number of studies identified distinct molecular pathways dysregulated in patients with pathogenicLMNAmutations, mouse models, or stem cells carryingLMNAmutations. Here, we summarize the current knowledge on the role of lamin A/C in diseases of the heart muscle and specifically focus on how changes in lamin-A/C-dependent chromatin architecture could be involved in the pathogenesis of cardiomyopathies. ## 2.LMNA-Related Dilated Cardiomyopathy Dilated cardiomyopathy (DCM) is characterized by enlargement and dilatation of one or both ventricles of the heart, which occurs together with impaired contractility and heart function [22]. TheLMNAgene is the second most commonly mutated gene in familial dilated cardiomyopathy (DCM), accounting for 5% to 8% of cases [23]. Patients carrying pathogenicLMNAmutations have a poor prognosis due to the high rate of sudden cardiac death resulting from malignant arrhythmias. Atrial fibrillation (AF), atrioventricular (AV) conduction block, ventricular tachycardia, and sudden cardiac death often precede the development of systolic dysfunction [24,25,26]. AlthoughLMNA-related DCM is an adult-onset disease, it cannot be excluded that structural changes and arrhythmias may be present in early asymptomatic individuals [27]. To date, around 500 mutations and 300 protein variants have been reported forLMNA; detailed information on the different mutations is available through the UMD-LMNAmutation database (www.umd.be/LMNA, accessed on 3 January 2023) (Table 1). Most of the mutations associated with cardiomyopathies are located in the head and rod domains and are mostly truncation or missense mutations [28]. Heterozygous truncation mutations often result in lamin A/C haploinsufficiency due to a premature termination codon generated by insertions or deletions resulting in a frameshift, aberrant splice site, or nonsense mutations. A homozygousLMNAnonsense mutation (Y259X) has also been reported, resulting in a lethal phenotype [29].LMNAmissense mutations, on the other hand, are thought to mostly act through a dominant negative mechanism [28]. Patients carrying heterozygous mutations inLMNAin combination with mutations within other genes such asTTN, DES, SUN1/2, etc., display a particularly severe clinical cardiac phenotype [30,31,32,33,34]. ### Table 1. Since a number ofLMNAmutations result in a loss of function, lamin A/C haploinsufficient (Lmna+/−) andLmnaknockout mice (Lmna-/-) have been extensively used to study the molecular mechanisms underlyingLMNAloss-of-function (LOF) cardiomyopathy (Table 2).Lmna−/− mice develop DCM two weeks after birth and die within one month [62,63].Lmna+/− mice are viable and fertile but already at ten weeks of age show AV conduction defects and atrial and ventricular arrhythmias, characteristic for patients withLMNALOF mutations [64]. Cellular characterization revealed thatLmnahaploinsufficiency results in AV node cardiomyocyte death and altered electrophysiological properties [64]. Furthermore,Lmna−/− andLmna+/− cardiomyocytes (CMs) show premature binucleation, cell cycle withdrawal, and abnormal contractility [63,65]. ### Table 2. Another mutation often used for modeling theLMNALOF mutation is the p.R225X mutation, a nonsense mutation causing premature truncation of both lamin A and lamin C splice isoforms. Patients carrying this pathogenic mutation show early onset of AF, secondary AV block, and DCM [87]. LikeLmna−/− mice, homozygoteLmnaR225X mice also exhibit retarded postnatal growth, conduction disorders, and DCM [36]. Other LOF mutations, e.g., K117fs and 28insA, also lead to a DCM phenotype.LMNAp. K117fs mutation is a frameshift mutation that leads to a premature translation-termination codon [38], whereas 28insA is an adenosine insertion mutation in exon 1 resulting similarly in a premature stop codon [40]. Messenger RNAs (mRNAs) that contain a premature stop codon often undergo degradation through the nonsense-mediated mRNA decay (NMD) surveillance mechanism and thus can cause haploinsufficiency. Consistent with this, a significant decrease in lamin A/C protein levels is observed in K117fs iPSC-CMs as a result of NMD-mediated degradation ofLMNAmRNA [38]. In addition to truncation mutations, which can result inLMNAhaploinsufficiency, mutations such as N195K, T10I, R541S, and R337H also show reduced lamin A/C protein levels [35,41]. Patients carrying these pathogenic mutations also develop DCM [26,51,88]. It is still unclear why these mutations lead to decreased lamin A/C levels. Possible reasons could be that protein translation or the stability of lamin A/C are affected in mutant CMs. For example, althoughLmnamRNA does not change, both lamin A and lamin C levels are decreased in CMs and MEFs derived fromLmnaN195K/N195K mutant mice [35]. Interestingly, patients carrying differentLMNAmissense mutations resulting in DCM also exhibit lower protein levels [89]. To what extent the decrease in lamin A/C levels or changes in protein function result in disease pathogenesis is still largely unknown and needs further investigation. Although it may seem that DCM is predominantly caused byLMNAhaploinsufficiency, missense mutations inLMNA, which do not lead to changes in lamin A/C protein levels, also result in DCM. For example,LMNAK219T missense mutation causing severe DCM and heart failure with conduction system disease [52] does not lead to obvious changes in lamin A/C levels in K219T iPSC-CMs [53].LMNAH222P missense mutation has been shown to cause Emery–Dreifuss muscular dystrophy (EDMD) and DCM in patients. Homozygous mice with the H222P mutation display muscular dystrophy, left ventricular dilatation, and conduction defects and die by 9 months of age [76]. Similarly to the K219T mutation, Western blot analysis of cardiac and skeletal muscle samples shows no obvious difference in lamin A/C protein levels between wild-type andLmnaH222P/H222P mice [74]. Interestingly, recent studies suggested a developmental origin ofLMNA-related cardiac laminopathy.LmnaH222P/H222P embryonic hearts showed noncompaction, dilatation, and decreased heart function already at E13.5[75], whileLmna+/− andLmna−/− embryonic hearts showed noncompaction cardiomyopathy with no decrease in ejection fraction [63]. Differentiation of mouse embryonic stem cells (ESCs) harboring theLmnap.H222P mutation revealed decreased expression of cardiac mesoderm marker genes, such asEomesandMesp1as well as cardiac progenitor (CP) markers and impaired CM differentiation. This is in stark contrast toLmna+/− andLmna−/− mESCs, which showed premature CM differentiation [63,75], suggesting different mechanisms behind the heart phenotype caused by lamin A/C haploinsufficiency or changes in protein functionality. Among laminopathy-associated missense mutations, the addition of proline is the most common. Proline addition can significantly alter protein structure. For example,LMNAS143P missense mutation causes DCM and disturbs the coiled-coil domain, thus affecting lamin A/C assembly into the nuclear lamina. This results in nuclear fragility and reduced cellular stress tolerance [49]. The addition of proline might also affect protein phosphorylation through proline-directed kinases, such as the mitogen-activated protein (MAP) kinases, cyclin-dependent protein kinase 5 (CDK5), glycogen synthase 3, etc. Mutations resulting in the addition of proline often result in striated muscle disease, suggesting a common underlying mechanism [90]. ## 3. Arrhythmogenic Right Ventricular Cardiomyopathy Arrhythmogenic right ventricular cardiomyopathy (ARVC) is an inherited heart muscle disorder that predominantly affects the right ventricle [91]. A progressive loss of myocytes and fibro-fatty replacement associated with arrhythmias in the right ventricular myocardium is a hallmark of the disease [92]. Mutations in desmosomal genes, such as Plakophilin 2 (PKP2), Desmoplakin (DSP), Desmoglein 2 (DSG2), Desmocollin 2 (DSC2), and junction plakoglobin (JUP), are the main cause of ARVC [93,94,95,96,97,98]. In addition, mutations in the calcium-handling protein Ryanodine Receptor 2 (RYR2) [99], Phospholamban (PLN) [100], the adherens junction protein Cadherin 2 (CDH2) [101], Integrin-Linked Kinase (ILK) [102], the signaling molecule Transforming Growth Factor-β3 (TGFB3) [103], the cytoskeletal structure protein Titin (TTN) [104], Desmin (DES) [105], transmembrane protein 43 (TMEM43), and lamin A/C (LMNA) have also been reported in ARVC [24,106,107,108]. In 2011, Quarta et al. first reported ARVC caused by mutations inLMNA. FourLMNAvariants were identified: R190W, R644C, R72C, and G382V [24]. The R190W and R644C variants also cause DCM and left ventricular noncompaction (LVNC). In addition, R644C can also lead to lipodystrophy and atypical progeria, thus showing an extreme phenotypic diversity. ARVC patients with these four mutations all exhibit RV dilatation and systolic dysfunction. Histological examination of the right ventricular myocardium from R190W and G382V patients showed a loss of more than 50% of myocytes and extensive interstitial fibrosis and fatty replacement [24]. Interestingly, immunohistochemical staining showed significantly reduced plakoglobin expression at the intercalated discs in the myocardium, which could contribute to the development of ARVC [24]. M1K, W514X, and M384I mutations inLMNAhave also been identified in ARVC. Patients with M1K and W514X mutations show RV dilatation, non-sustained ventricular tachycardia, and complete atrioventricular block [108]. A patient with the M384I variant not only developed ARVC but also peripheral neuropathy and peroneal muscular atrophy [109]. So far, it remains unknown howLMNAmutations result in ARVC. SinceLMNAis a ubiquitously expressed protein, its mechanoprotective function in cardiomyocytes, which can limit the progressive loss of myocytes, its role in the regulation of genes involved in cardiac contractility, and its important role in regulating cell fate choices, which may result in an excess of fibroblasts and adipocytes, might be involved. Tracing back the origins of fat tissue in a mouse model of ARVC, Lombardi et al. suggested that second heart field (SHF)-derived progenitor cells switch to an adipogenic fate through nuclear plakoglobin (JUP)-mediated Wnt signaling inhibition [110]. A subset of resident cardiac fibro-adipocyte progenitor cells characterized by PDGFRAposLinnegTHY1negDDR2negexpression signatures have been shown to be a major source of adipocytes in ARVC caused by Desmoplakin (DSP) haploinsufficiency [111]. Furthermore, the endocardium, epicardium, and cardiac mesenchymal stromal cells also serve as a source of adipocytes in the heart [112,113,114]. Because the endocardium and epicardium give rise to diverse cardiac cell lineages, including mesenchyme and adipocytes [115], via endothelial-to-mesenchymal transition (EndMT) and epithelial-to-mesenchymal transition (EMT), lamin A/C function in regulating EMT [75] might also be a key mechanism driving ARVC pathogenesis. ## 4. Left Ventricle Noncompaction Cardiomyopathy Left ventricular noncompaction (LVNC) cardiomyopathy is a rare congenital heart disease resulting from abnormal development of the endocardium and myocardium. Patients with LVNC exhibit a thin compact myocardium and excessive trabeculation and can eventually develop progressive cardiac dysfunction followed by heart failure. LVNC can manifest together with other cardiomyopathies and congenital heart disease [116]. Studies have identified various genes associated with LVNC, such asTTN,MYH7,TNNT2,LDB3,MYBPC3,ACTC1,DSP,CASQ2,RBM20, and the intermediate filamentsDES[117] andLMNA[118], with the two most affected genes beingTTNandLMNA[119]. The first reportedLMNAmutant variant causing LVNC is R190W, which is also associated with familial DCM and ARVC [56]. Another pathogenicLMNAvariant causing LVNC isLMNAR644C. R644C mutation carriers show an extreme phenotypic diversity, ranging from DCM and LVNC to lipodystrophy and atypical progeria [59]. Parents and colleagues reported four family members with theLMNAR644C mutation, three of whom developed left ventricular noncompaction cardiomyopathy with normal LV dimensions and function and without evidence of dysrhythmias [60]. Other mutations such asLMNAV74fs, R572C, and V445E have also been associated with LVNC. Patients with the V445E missense mutation are characterized by an arrhythmogenic form of LVNC, suggested to be due to dysfunctional SCN5A [58,119]. HowLMNAmutations result in LVNC and the mechanisms underlying the high phenotypic diversity are largely unknown. Two recent studies demonstrated thatLmnaH222P/H222P as well asLmna−/− andLmna+/− embryonic hearts exhibit noncompaction, suggesting these mouse models as important tools to study the developmental origin and the mechanisms behindLMNA-mediated noncompaction cardiomyopathy [63,75]. Interestingly, our own study revealed thatLmnaLOF results in abnormal cell fate choices during cardiogenesis, i.e., promotes CM and represses endothelial cell fate. Since the crosstalk between CMs and endothelial cells is instrumental for proper cardiac development and myocardial compaction [120], abnormal cardiovascular cell fate choices and dysfunctional endothelium might also contribute to LVNC. Thus, understanding the link between alternative cell fate choices, changes in cell behavior, and tissue-specific phenotypes caused by pathogenicLMNAmutations would be an important question to address in further studies. ## 5. Restrictive Cardiomyopathy Restrictive cardiomyopathy (RCM) is a rare cardiac disease characterized by increased myocardial stiffness resulting in impaired ventricular filling. Patients with RCM show enlarged atria and diastolic dysfunction, while systolic function and ventricular wall thicknesses are often normal until the later stages of the disease [121,122,123]. Although most causes of RCM are acquired, several gene mutations have also been identified in patients with RCM [121,122,123,124]. The most common mutated genes found in RCM are sarcomere-related genes such asTTN[125],TNNI3[126],MYH7[127],ACTC1[128], etc. Mutations in non-sarcomere genes such asDES[129],TMEM87B[130],FLNC[131], etc., have also been reported. Recently, Paller et al. reported a truncation mutation ofLMNA(c.835 delG:p.Glu279ArgfsX201) in an RCM patient who had a significant biatrial enlargement, atrial fibrillation, and skeletal muscle weakness. Both right and left ventricular size and function were normal, and histological analysis revealed cardiac hypertrophy and focal interstitial fibrosis in the endomyocardial tissue [61]. HowLmnamutations cause RCM is not known; a plausible mechanism could be the activation of profibrotic signaling, as discussed below. ## 6. Molecular Mechanisms Resulting inLMNA-Related Cardiomyopathy Pathogenesis SinceLMNA-related cardiomyopathies caused by distinct point mutations show phenotypic diversity, the precise molecular mechanisms resulting in disease pathogenesis are also distinct and complex. Taking into account the variety of different functions of the nuclear lamina, three central mechanisms have been suggested to drive disease pathogenesis. The “mechanical hypothesis” proposes that disruption of the nuclear lamina causes increased nuclear fragility and increased susceptibility to mechanical stress [132]. This hypothesis is supported by observations that CMs from patients or mouse models with lamin A/C mutations exhibit nuclear rupture, DNA damage, and cell cycle arrest [63,65,88,133]. Interestingly,Lmna−/− non-CMs subjected to stretch show significantly increased DNA damage, further supporting the notion that the elevated cell death could be due to the inability ofLmna−/− CMs to respond adequately to mechanical stress [63]. Importantly, a recent study revealed that disrupting the LINC complex and thereby decoupling the nucleus/nucleoskeleton from the mechanical forces transduced by the cytoskeleton increases more than fivefold the lifespan ofLMNA-deficient mice [134], pointing to therapeutic opportunities for patients carrying mutations resulting in nuclear fragility. Myriad studies have demonstrated a role of lamins in regulating MAPK, TGF-β, Wnt–β-catenin, and Notch signaling cascades [135,136] and suggested that altered signaling is a key driver ofLMNA-related dilated cardiomyopathy. For instance,LMNA-related cardiomyopathy shows a significant increase in myocardial fibrosis which contributes to left ventricular dysfunction and heart failure [24,35,137,138]. Profibrotic signaling, such as TGF-β, MAPK, and ERK signaling, is activated inLmnaH222P/H222P mice, and the partial inhibition of ERK and JNK signaling before the onset of cardiomyopathy inLmnaH222P/H222P mice significantly reduces cardiac fibrosis and prevents the development of left ventricle dilatation and decreased cardiac ejection fraction [138,139,140,141]. Indeed, therapies targeting intracellular signaling alterations are being developed in a preclinical setting [142]. Since nuclear lamins anchor chromatin at the nuclear periphery, the “chromatin hypothesis” suggests that chromatin alterations as a result ofLMNAhaploinsufficiency or mutation result in abnormal gene expression programs responsible for the disease phenotype [132]. In the last years, a number of studies using iPSC-CMs or mESC-CMs uncovered changes in chromatin architecture coupled to transcriptional changes in different ion channels such asSCN5A,CACNA1A/C/D,HCN4,SCN3b, andSCN4b, as well asPdgfbpathway activation, which might explain the arrhythmogenic conduction defects inLMNApatients [38,53,63,143]. ## 7. Epigenetics inLMNA-Related CARDIOMYOPATHIES As already mentioned, the nuclear lamina shapes higher-order chromatin structure by anchoring large heterochromatic regions (~ 0.1–10 Mb stretches) at the nuclear periphery, termed lamina-associated domains (LADs). LADs are enriched in the repressive histone marks H3K9me2/3 and H3K27me3, and genes associated with LADs are mostly inactive [15]. Although most LADs are conserved between cell types (constitutive LADs (cLADs)), some chromatin nuclear lamina interactions are detected in specific cell types (facultative LADs (fLADs)) (Figure 2) [144,145]. Indeed, genome–nuclear lamina dynamics have been proposed to play a key role in cell fate decisions by “locking” or “unlocking” genes conferring cell identity at the nuclear periphery [145,146]. For example, during mESC differentiation into astrocytes (ACs), specific AC genes detach from ESC LADs resulting in gene activation. A substantial number of genes are not immediately activated upon detachment from the nuclear lamina but rather become primed for activation at a later stage [145]. Similar mechanisms also occur during CM differentiation. HDAC3 directly represses cardiac differentiation by tethering CM genes to the nuclear lamina. The loss of HDAC3 in cardiac progenitor cells releases these genomic regions from the nuclear periphery, leading to early cardiac gene expression and differentiation [147]. Our own study further showed that lamin A/C and not B-type lamins is responsible for the early activation of a transcriptional program promoting CM versus endothelial cell fate and differentiation [63]. Interestingly, lineage shifts uponLMNAloss or mutation have been reported in other tissues, suggesting that aberrant activation of genes driving an unscheduled differentiation could be a common feature of laminopathic cells [148,149,150,151]. Similar to ACs, we found two modes of regulation: (i) Lamin A/C keeps cell differentiation and cardiac morphogenesis genes silent, such asGata4/6,Bmps,Wnts,Myl4, etc. Upon lamin A/C LOF, these genes are ectopically expressed in mESCs. (ii) Lamin A/C restricts transcriptional permissiveness at cardiac structural and contraction genes, such asRyr2,Mybpc3,Adrb2, etc. Upon lamin A/C LOF, chromatin becomes more accessible, but this is not sufficient to elicit gene transcription in ESCs. However, during cardiac differentiation, these primed loci are readily accessible to cardiac transcription factors (TFs), resulting in aberrant cardiovascular cell fate choices, premature CM maturation, cell cycle withdrawal, and abnormal contractility. In contrast,LmnaH222P/H222P mESCs, or mESCs harboring the G609G mutation causing accelerated aging, did not show similar changes in chromatin accessibility nor in expression patterns, supporting the view that the molecular mechanisms underlying the distinct phenotypes upon lamin A/C LOF and missense mutations are different [63]. [cells-12-00783-f002] Many recent studies have focused on the role of lamin A/C in chromatin organization in human induced pluripotent stem cell (hiPSC)-derived CMs (hiPSC-CMs) to pinpoint the molecular mechanisms associated withLMNAcardiomyopathy. For instance, in hiPSC-CMs harboring the frameshift mutation K117fs that leads to lamin A/C haploinsufficiency, chromatin accessibility is increased at lamin A/C LADs, leading to transcriptional activation. Among others, the PDGF pathway was highly activated in K117fs iPSC-CMs and its inhibition rescued the arrhythmic phenotype, suggesting that PDGF inhibitors could be beneficial in preventing fatal arrhythmias often manifested in patients withLMNA-related cardiomyopathy [38]. Notably, the authors found that many genes located in non-LAD regions are also highly upregulated in K117fs iPSC-CMs compared to controls, suggesting that mutations in lamin A/C might also result in maladaptive epigenetic remodeling at non-LAD regions. This might be mediated through changes in B-type lamin function, upregulation of pioneer transcription factors, loss of binding of repressive complexes, or other mechanisms. Indeed, although B-type lamins form distinct meshworks, the loss of A-type lamins results in alterations in B-type meshworks, suggesting that their activity might be interconnected [152]. Thus, mutation-mediated changes in lamin A/C activity might also affect lamin B1/B2 function. Interestingly, lamin B2 plays an essential function in regulating CM karyokinesis, andLmnb2ablation resulted in polyploid CM nuclei in neonatal mice [153].Lmnaablation also results in increased numbers of binucleated CMs in neonatal mice [63], suggesting that lamin A/C loss might affect lamin B2 function. The activation of pioneer transcription factors, which can engage developmentally silenced genes embedded in “closed” chromatin [154,155,156,157] and induce chromatin opening, might also play a role inLMNA-related cardiomyopathies. Indeed, the pioneer cardiac TF GATA4 is activated by lamin A/C loss, andGata4silencing or haploinsufficiency rescues the abnormal cardiovascular cell function induced by lamin A/C deficiency [63]. Another pioneer TF, FoxO1 [158], also shows increased binding to chromatin uponLmnaLOF. FoxO TFs play key functions in stress response, cell proliferation, and apoptosis, and the longevity and suppression of FoxO activity in CMs partially rescues the cardiac phenotype and prolongs survival [159]. Additionally, the nuclear lamina may serve as a binding platform for chromatin remodelers, such as the Polycomb Group Proteins, which can initiate large-scale epigenetic alterations. This will be discussed in the following section (Figure 3). [cells-12-00783-f003] Another study using an iPSC model harboring the T10I mutation inLMNAsuggested a role of the nuclear lamina in safeguarding cellular identity [41]. In T10I iPSC-CMs, the peripheral heterochromatin enriched for non-myocyte lineage genes was disrupted, resulting in the activation of alternative cell fate genes. Upregulation of non-cardiac genes was also observed in iPSC-CMs carrying the R225X mutation in lamin A/C (Figure 2B). Importantly,CACNA1A, encoding a neuronal P/Q-type calcium channel, was upregulated, and pharmacological inhibition partially rescued the altered electrophysiological properties of R225X iPSC-CMs [143]. In this context, it is important to note that in contrast to mouse/human blastocysts and naïve mouse mESCs, hiPSCs cultured in standard conditions represent a primed state and do not express detectable levels of lamin A/C protein [63]. Since lamin A/C plays an important role in chromatin organization in naïve pluripotent stem cells, which is essential for normal cardiogenesis, some important aspects of lamin A/C function cannot be modeled using hiPSCs and requires studies using naïve hiPSCs carryingLMNAmutations. In addition, chromatin and expression analysis of CMs from patients with differentLMNA-related DCM mutations revealed extensive rearrangement ofLMNA–chromatin interactions in DCM patients [89]. The reorganization of lamin A/C LADs is associated with altered CpG methylation and dysregulated expression of a large number of genes involved in cell metabolism, the cell cycle, and cell death. Most of theLMNA-related DCM patients’ samples used in this study showed a decrease in lamin A/C protein levels, suggesting thatLMNALOF might account for the observed DNA, chromatin, and expression changes [89]. It is still poorly understood how cell-type-specific tethering at the nuclear lamina is achieved and how mutations in lamins affect the tethering of key cell fate determinants in stem cells and in cells already committed to a certain lineage. Lamins interact with chromatin either directly [160] or indirectly through chromatin-binding proteins. Consistent with its association with both hetero- and euchromatin, lamin A/C interacts with proteins associated with both hetero- and euchromatin, e.g., LAP2α, Emerin, and BANF1 [161,162], while B-type lamins interact with the lamin B receptor (LBR), which mediates the attachment to the inner nuclear membrane, and Heterochromatin Protein 1 (HP1α) associated with heterochromatin [163]. However, all these proteins are broadly expressed and cannot account for the cell-type-specific tethering of LADs. Thus, identifying cell-type-specific interacting partners for nuclear lamins and the effect of lamin mutations on these interactions will be key in understanding the molecular mechanisms underlying the wide-ranging clinical phenotypes and may pinpoint druggable protein–protein interfaces for therapeutic applications. Moreover, how mutations in lamin A/C affect the separation into relatively active and inactive chromatin regions is still debatable [164]. The genome is organized into higher-order structural domains referred to as topologically associated domains (TADs). TADs tend to interact based on their epigenetic status and transcriptional activity, thus dividing chromosomes into two types of large-scale compartments generally called A compartments (active) and B compartments (inactive) (Figure 3A) [165]. An analysis of A/B compartment changes revealed only ∼1.2% compartment switches in R225X iPSC-CMs with only a minimal correlation with highly dysregulated genes [143]. In contrast, during cardiac differentiation, ∼20% of the genome undergoes A/B compartment reorganization, while many others appear constitutively associated with the nuclear lamina. Interestingly, inLmna−/− mESC, around 8% of the chromatin compartments switched from A to B and vice versa as a result of lamin A/C loss. These compartment switches highly overlap with lamin A LADs. Genes within the B/A compartment switches (inactive to active) were linked to calcium ion transmembrane transport, muscle cell differentiation, and relaxation of cardiac muscle, including genes such asMyl4,Atp2a3,Ryr2, andCamk2d, which were either activated or primed upon lamin A/C loss. Lamin A/C is expressed in naïve pluripotent stem cells, absent after the loss of pluripotency and during early differentiation, and re-expressed in CMs. This dynamic expression pattern may provide a window of opportunity for LAD and chromatin compartment reorganization, and the activation of transcriptional programs driving important developmental decisions and cell identity. As we discussed before, LADs are enriched for H3K27me3. The downregulation of lamin A/C remodels the repressive H3K27me3 and the permissive H3K4me3 histone marks, thereby enhancing transcriptional permissiveness [166]. Indeed, lamin A/C interacts with the Polycomb repressive complex 2 (PRC2) complex, which catalyzes H3K27me3 [167], and lamin A/C loss in myoblasts results in PcG protein foci disassembly, ectopic expression of Polycomb targets, and premature myogenic differentiation [167]. Polycomb Group (PcG) proteins are key epigenetic repressors during development and differentiation. The Polycomb repressive complex 2 (PRC2)-mediated deposition of H3K27me3 recruits the canonical Polycomb repressive complex 1 (PRC1) that monoubiquitinates lysine 119 of histone H2A (H2AK119ub1) and induces chromatin compaction. The core PRC2 is formed by EED, SUZ12, and the catalytic components EZH2 or EZH1 (Figure 3B) [168,169]. Both PRC1 and PRC2 play an important role in cardiac development and differentiation. EZH2 is essential for CM proliferation, survival, and postnatal cardiac homeostasis. The inactivation ofEzh2specifically in cardiac progenitors results in ectopic transcriptional programs and lethal heart defects [170,171]. PRC2 function also ensures proper cardiac growth, andEedablation by TnT-Cre leads to myocardial hypoplasia and embryonic lethality [170,171]. In a mouse model of EDMD, lamin A/C loss results in PcG repositioning and de-repression of non-muscle genes in muscle satellite stem cells together with the activation ofp16INK4athat induces cell cycle arrest. This aberrant transcriptional program causes impairment in self-renewal, loss of cell identity, and premature exhaustion of the quiescent satellite cell pool [172]. In a recent study using iPSC-CMs carrying the cardiac-laminopathy-associated K219T mutation, it was shown that the binding of lamin A/C together with PRC2 at theSCN5Apromoter represses its expression, resulting in decreased conduction velocity [53]. Together, aberrant PRC activity uponLMNAmutation might play an important role inLMNA-related cardiomyopathies (Figure 3B). ## 8. Advances in Therapeutic Strategies forLMNA-Related Cardiomyopathy The clinical management ofLMNA-related DCM includes pharmacological treatment with ACE inhibitors and beta blockers and implantable cardiac defibrillators (ICDs) [173,174]. Heart transplantation or ventricular assist devices may also be required for patients in the end stages of heart failure [173,174]. The inhibition of mTOR, MAPK, and LSD1 significantly rescues theLMNA-related DCM phenotype in mice [75,138,175], and a novel and selective p38 MAPK inhibitor is now in a phase 3 clinical trial inLMNA-related DCM [176]. In addition, CRISPR/Cas9-based genome editing strategies have been used inLMNA-caused Hutchinson–Gilford Progeria Syndrome (HGPS) and show promising results [177,178,179]. By using guide RNAs (gRNAs) that targetLMNAexon 11 to specifically interfere with lamin A/progerin expression, both Santiago-Fernández et al. and Beyret et al. show a reduced progerin expression and improvement in the progeria phenotype in an HGPS mouse model [177,178]. However, off-target effects, e.g., resulting from insertion and deletions during non-homologous end joining (NHEJ), are a major concern. To overcome these limitations, CRISPR/Cas9-mediated base pair editing systems have been used in HGPS mice [179]. Base pair editing systems could modify the genome without the need of double-strand DNA breaks or donor DNA templates [180]. Two classes of DNA base editors have been reported: cytosine base editors (CBEs), which convert C:G to T:A, and adenine base editors (ABEs) which convert A:T to G:C [181,182]. Systemic injection of a single dose of dual AAV9 encoding ABE and sgRNA into an HGPS mouse model significantly extends the median lifespan of the mice, improves aortic health, and fully rescues VSMC counts as well as adventitial fibrosis [179]. Despite the power of the base pair editing technology, a major limitation is the inability to edit the genome beyond four transition mutations. Prime editing represents a novel approach which is not only suitable for all transition and transversion mutations but also for small insertion and deletion mutations [183]. Similar to base pair editing, prime editing does not require double-strand DNA breaks or donor DNA templates [183] and could be used in the correction of genetic cardiomyopathies. ## 9. Conclusions and Perspectives Accumulating evidence shows that epigenetic alterations play a crucial role inLMNA-related cardiomyopathies. Mutations inLMNAaffect 3D genome architecture and chromatin accessibility, thereby altering gene expression programs. Several prospective target genes, such asPDGFRB,Gata4,SCN5A, andCACNA1A,have been identified using experimental models harboring differentLMNAmutations, which may serve as potential therapeutic targets. As reviewed above, specificLMNAvariants can cause extreme phenotypic diversity, which makes it challenging to understand the primary changes underlying disease pathogenesis and thus to design specific treatment strategies for patients. Therefore, an important question remains: how do different and specificLMNAmutations result in phenotypic diversity? Environmental factors, such as diet, exercise, and stress, as well as age, sex, and other comorbidities, might also contribute to the phenotypic variability in patients with pathogenicLMNAmutations. Identifying cell-type-specific interacting partners for nuclear lamins and the effect of lamin mutations on these interactions would also be important in understanding the wide-ranging clinical phenotypes and may pinpoint druggable protein–protein interfaces for therapeutic applications. Given the important role of lamin A/C in heart development and CM differentiation, developmental changes in asymptomatic-at-birthLMNApatients might result in late changes in heart structure and function, warranting further investigation. ## Author Contributions Conceptualization, Y.W. and G.D.; writing—original draft preparation, Y.W.; writing—review and editing, G.D.; visualization, Y.W. and G.D.; funding acquisition, G.D. All authors have read and agreed to the published version of the manuscript. ## Institutional Review Board Statement Not applicable. ## Informed Consent Statement Not applicable. ## Data Availability Statement No new data were created. ## Conflicts of Interest The authors declare no conflict of interest. ## Funding Statement This work was supported by the SFB1366 (Project A03), SFB1550 (Project A03) funded by the DFG, and the DZHK (81Z0500202, 81X2500216), funded by BMBF. ## Footnotes ## References ## Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. ### Data Availability Statement No new data were created.	[ "Yinuo Wang", "Gergana Dobreva" ]	Cells	10.3390/cells12050783	36899919	3	3	948	37,302
PMC10002385	Application of Nicotinamide to Culture Medium Improves the Efficiency of Genome Editing in Hexaploid Wheat	Histone acetylation is the earliest and most well-characterized of post-translation modifications. It is mediated by histone acetyltransferases (HAT) and histone deacetylases (HDAC). Histone acetylation could change the chromatin structure and status and further regulate gene transcription. In this study, nicotinamide, a histone deacetylase inhibitor (HDACi), was used to enhance the efficiency of gene editing in wheat. Transgenic immature and mature wheat embryos harboring a non-mutatedGUSgene, theCas9and aGUS-targeting sgRNA were treated with nicotinamide in two concentrations (2.5 and 5 mM) for 2, 7, and 14 days in comparison with a no-treatment control. The nicotinamide treatment resulted inGUSmutations in up to 36% of regenerated plants, whereas no mutants were obtained from the non-treated embryos. The highest efficiency was achieved when treated with 2.5 mM nicotinamide for 14 days. To further validate the impact of nicotinamide treatment on the effectiveness of genome editing, the endogenousTaWaxygene, which is responsible for amylose synthesis, was tested. Utilizing the aforementioned nicotinamide concentration to treat embryos containing the molecular components for editing theTaWaxygene, the editing efficiency could be increased to 30.3% and 13.3%, respectively, for immature and mature embryos in comparison to the 0% efficiency observed in the control group. In addition, nicotinamide treatment during transformation progress could also improve the efficiency of genome editing approximately threefold in a base editing experiment. Nicotinamide, as a novel approach, may be employed to improve the editing efficacy of low-efficiency genome editing tools such as base editing and prime editing (PE) systems in wheat. Keywords:nicotinamide, wheat, CRISPR/Cas9, histone deacetylase inhibitors, editing efficiency, base editing	## 1. Introduction The development and application of genome editing technology has provided important technical support for plant functional gene research and crop genetic improvement. Compared with other developed genome editing technologies, CRISPR/Cas systems have the advantages of simple operation and high efficiency. Since the first application of CRISPR/Cas9 genome editing technology in eukaryotes in 2013 [1,2], it has become a revolutionary tool in the life sciences. The CRISPR/Cas9 system has been widely used for genome engineering in diverse eukaryotic species. Now, it is becoming a powerful biology tool for human gene therapy and plant breeding. CRISPR/Cas9 is mainly applied in crop genome editing for studies of gene function and genetic improvement. Editing efficiency is an important issue for the CRISPR/Cas9 technique. There are several factors which normally influence efficiency. First, different gene editing tools and Cas9 variants have different editing efficiency levels. The editing efficiencies of SpCas9, CjCas9, SaCas9, StCas9, NmCas9, Cpfl, SpCas9NG, XCas9, SPG, and SPR were different [3,4,5,6] and up until now, the CRISPR/Cas9 system was the most efficient and widely used solution for genome editing. Second, editing efficiency is also influenced by the the integration locations and expression levels of theCas9and targeted sgRNA in the genome of transgenic plants ae well as the structures of the sequences of the sgRNA in the genome [4]. Third, the editing efficiency of the CRISPR systems differs in different species. For instance, the editing efficiency of Cpf1 reached 75% in rice [7] but only 3.1% in wheat [8]. It is generally believed that genome editing is more difficult in polyploid than diploid plants because there is only one copy of a functional gene in diploid plants and multiple copies in polyploid ones. Target traits are only displayed when their multiple controlled genes are edited simultaneously in a single polyploid plant. For example, although the editing efficiencies of wheatTaMTLandTaWaxygenes were up to 57.5% and 80.5%, respectively, the simultaneous editing efficiencies at their three loci were only 12.9% and 32.2%, respectively [8]. Finally, environmental conditions and artificial treatments could affect the editing efficiency of CRISPR. It was reported that high-temperature treatment increased the editing efficiency of Cpf1 inArabidopsis, rice, maize, and wheat [9,10]. Previous reports reported that chromatin structure could influence the genome editing efficiency in different eukaryotic cells [11,12]. In general, eukaryotic genomic DNA is wrapped around histones, which first form nucleosome structures and further compact into higher-order chromatin structures [13,14]. Chromatin structures actually involve an alternation between open and closed states. The regions which have low concentrations of histones, or naked DNA, are called open chromatin; DNA replication and gene transcription occur in these regions [15]. Thereby, the activity of the Cas9 protein is significantly different between the closed area winding the nucleosome and the open area, and Cas9 cannot bind to the DNA on the nucleosome [14,16,17]. The binding site of Cas9 in mammals was found that the binding of Cas9 to target genes mainly occurred in the open chromatin region [11]. In fact, the efficiency of CRISPR/Cas9-induced insertion and deletions (indels) in human cells was higher at the sites in open chromatin regions than in closed chromatin regions [18]. Based on the published genomic data and other available information on rice, the editing efficiency of CRISPR/Cas9 in open regions was higher than that in closed regions [19]. To our knowledge, chromatin remodeling can make the core histone octamer slide on the DNA strand and change the distance between nucleosomes or the conformation of nucleosomes by replacing histone variants or removing the nucleosomes [20]. Thus, gene replication, recombination, transcription, and expression can be regulated through exposure of the promoter and enhancer or DNA replication of target genes [20]. There are two main types of enzymes that regulate the process of chromatin remodeling: ATP-dependent chromatin remodelers and histone modifiers. It has been demonstrated that the interaction between histone acetylation modifications and transcription factors is beneficial, promoting chromatin opening, and that it could potentially improve the editing efficiency of the CRISPR system [21]. Histone acetylation, as the earliest and most well-characterized of post-translation modifications, plays a major role in chromatin remodeling. Histone acetylation, which is mediated by histone acetyltransferases (HAT) and histone deacetylases (HDAC), can change chromatin structures and regulate gene transcription, DNA replication, and repair [22]. Histone deacetylase inhibitors (HDACis) were used to treat the HEK293T cell line by adding acetyl groups into histones to promote the opening of chromatin, and the editing efficiency of CRISPR/Cas9 system was improved [23]. Sodium butyrate and nicotinamide are two commonly applied histone deacetylase inhibitors (HDACis). Sodium butyrate is a short-chain fatty acid that inhibits theArabidopsisRPD3/HDA1 inHDACgene family [24]. Nicotinamide, as a derivative of vitamin B3 and a product of the SIR2 HDAC family deacetylation reaction, inhibits the function of HDACs in mammals and yeast [25,26]. The exposure of maize cells to HDACis led to open chromatin structures in the region of target genes and further improved the efficiency of oligonucleotide-directed mutagenesis (ODM) [27]. In our previous study, wheat seedlings were treated with nicotinamide, and transcriptome analyses found that nicotinamide treatment would change the expression of chromatin state-related genes [28]. In this study, we investigated the effects of nicotinamide in different concentrations on several wheat transgenic tissues, including immature embryos, mature embryos, and calluses, to enhance genome editing efficiency through alterations in chromatin status. Our results provide a new strategy to improve wheat genome editing efficiency. ## 2. Results ### 2.1. Effect of Nicotinamide Treatment of Transgenic Wheat Immature Embryos on the Mutation Efficiency of GUS Gene The T1transgenic plants harboring theCas9and aGUS-targeting sgRNA generated earlier by the pMWB110-SpCas9-TaU3-GUS vector, denoted GUC plants in which theGUSgene was not edited [8], were planted in a greenhouse for this experiment. In order to confirm if the T1plants still carry thebargene linked toCas9, PCR was performed (Figure S1a), which resulted in detection of thebargene in 48 plants out of the 62 plants tested. Then, the lack of the mutations in theGUSgene in thebar-positive plants was tested with PCR-RE (Figure S1b). No mutation in theGUSgene was detected in any of the transgenic plants tested. In total, 240 immature embryos, collected from the positive T1plants, were cultured with 2.5 and 5.0 mM nicotinamide for 2, 7, and 14 days designated as 2-2.5-G, 2-5-G, 7-2.5-G, 7 -5-G, 14-2.5-G, and 14-5-G, respectively, and without nicotinamide designated as 2-G, 7-G, and 14-G. When the cultured T2plants were transplanted into pots, they were all analyzed for the presence of thebargene, and 173 plants were confirmed to contain thebargene as well asCas9/sgRNAexpression cassette. Then, the mutations ofGUSgene in the positive plants were tested by PCR-RE (Figure S2). There were no edited plants in 2-G, 2-2.5-G, and 2-5-G groups (Figure S2a), while 3 and 4 mutations were detected in groups 7-2.5-G and 7-5-G with mutation efficiencies of 16.7% and 21.1%, respectively (Figure S2b). Furthermore, 9 and 4 mutations were found in groups 14-2.5-G and 14-5-G with editing efficiencies of 36.0% and 17.4%, respectively (Table 1). Moreover, one homozygous mutant plant was detected in group 14-2.5-G. The mutation efficiency ofGUSafter 2.5 mM nicotinamide treatment for 14 d was the highest (36.0%). #### Table 1. To further confirm the new mutants after nicotinamide treatment, theGUSgene in the plants was sequenced and analyzed. The GUS staining showed that the homozygous mutant did not exhibit blue coloring, while the other heterozygous mutants still expressed theGUSgene (Figure 1a). The types of mutations inGUSgene in the new mutants were mainly 1 bp, 3 bp, 5bp, and 12 bp deletions after sequencing (Figure 1b). [ijms-24-04416-f001] ### 2.2. Effect of Nicotinamide Treatment to Transgenic Wheat Immature Embryos on the Mutation Efficiency of TaWaxy Genes In order to further confirm the effects of nicotinamide treatment, the transgenic T0plants, which had no mutations within endogenousTaWaxygenes and harboredCas9and aTaWaxy-targeting sgRNA cassette (denoted WUC plants), were analyzed for the presence ofbargenes by PCR and mutations ofTaWaxygenes by PCR-RE (Figure S3a,b). The results indicated that there was still no mutation in theTaWaxygene in the plants testing positive. Then, the immature embryos of T0WUC plants were cultured on 2.5 and 5.0 mM nicotinamide and control medium for 14 days. There were 58, 71, and 64 embryos for 14-W1, 14-2.5-W1, and 14-5-W1 groups, respectively. After the cultured plants were transplanted into pots, 44, 53, and 48 positive plants were confirmed in 14-W1, 14-2.5-W1, 14-5-W1, respectively, after PCR testing for thebargene. Three pairs of specific primers were used to detect mutations ofTaWaxygenes on chromosomes 4A, 7A, and 7D by PCR-RE (Figure S4). There was still no mutation detected in 14-W1, while 7 and 5 mutations were detected in 14-2.5-W1 and 14-5-W1, respectively, with mutation efficiencies of 13.2% and 10.4% (Table 2). In group 14-2.5-W1, 2, 3, and 5 mutations were detected at the loci on 4A, 7A, and 7D, respectively, and the simultaneously mutation frequencies for one, two, and three loci were 7.5%, 5.7%, and 0%, respectively (Table 2). In group 14-5-W1, 1, 2, and 4 mutations were detected at the three loci with editing efficiencies of 2.1%, 4.1%, and 8.4%, respectively, and the simultaneous mutation frequencies for one, two, and three loci were 6.3%, 4.2%, and 0%, respectively (Table 2). Additionally, it was found that the editing efficiency in 14-2.5-W1 was slightly higher than that in 14-5-W1. #### Table 2. Considering that nicotinamide treatment can significantly improve editing efficiency in transgenic and unedited wheat plants and obtain the edited plants at up to two loci simultaneously, we treated the edited plants at one locus to obtain edited plants at three loci. Hence, a total of 42 immature embryos of the transgenic and edited wheat plants which had either one mutation among the three loci on chromosomes 4A, 7A, and 7D were treated on 2.5 and 5.0 mM nicotinamide and control for 14 d. There were only 12, 13, and 8 positive cultured plants, respectively, confirmed in groups 14-W2, 14-2.5-W2, and 14-5-W2 afterbargene detection. Based on the detection results by PCR-RE (Figure S5), new mutation efficiencies of 8.3%, 30.8%, and 25.0% were achieved in 14-W2, 14-2.5-W2, and 14-5-W2, respectively (Table 3). In 14-W2, only one plant had two mutations, at the loci on 4A and 7A, in which the mutation on 4A was newly edited. In 14-2.5-W2, three plants with two locus mutations and one plant with three loci mutations were identified, respectively, with a new mutation efficiency of 30.8%. In 14-5-W2, two loci mutations were found in two plants. It could be summarized that the 2.5 mM nicotinamide was the best concentration to treat immature wheat embryos with the goal of creating new editing loci. #### Table 3. To further confirm the new mutants after nicotinamide treatment on the immature embryos, theTaWaxygene in the candidate mutant plants was sequenced and analyzed. The types of mutations inTaWaxygene mutants were mainly 1 bp, 4 bp, 7 bp, 13 bp, 533 bp deletion mutations and a 1 bp insertion mutation. (Figure 2). [ijms-24-04416-f002] ### 2.3. Effects of Nicotinamide Treatment of Transgenic Mature Wheat Embryos on the Mutation Efficiency of TaWaxy Genes In order to explore the effects of nicotinamide treatment of transgenic mature wheat embryos on the mutation efficiency ofTaWaxygenes, we harvested the seeds of T1transgenic plants with expression editing cassettes and without mutations. Their mature embryos were cultured on control medium and treatment medium containing 2.5 and 5.0 mM nicotinamide for 14 d, and then the in-vitro-treated plantlets were moved into pots after sufficient growth. Afterbargene detection, 21, 15, and 8 positive plants were identified in 14-W3, 14-2.5-W3, and 14-5-W3, respectively. Furthermore, based on PCR-RE detection (Figure S6), no mutations were detected in 14-W3, but two edited plants were found in 14-2.5-W3 and one edited plant was found in 14-5-W3, with mutation efficiencies of 13.3% and 12.5%, respectively (Table 4). When the mutations were detected by sequencing, the results showed that the mutation types inTaWaxygene in the mutants were mainly 1 bp and 4 bp deletions and a 1 bp insertion (Figure 3). #### Table 4. [ijms-24-04416-f003] ### 2.4. Determination of Available Concentration of Nicotinamide Treatment during Wheat Genetic Transformation Steps To confirm if nicotinamide treatment was able to influence wheat genetic transformation, different dosages of nicotinamide (0, 2.5, and 5 mM) were added into the WLS-Res medium in the genetic transformation of NGT2 vector using the immature embryos of Fielder byAgrobacterium. The results clearly showed that the addition of nicotinamide to medium inhibited the growth of callus (Figure 4). With increased nicotinamide concentration, callus growth was significantly negatively influenced, and callus differentiation capacity was also greatly decreased. Obviously, the concentration of nicotinamide was negatively correlated with the efficiency of wheat transformation (Table 5). The efficiency reached up to 93.0% for NGT2 without nicotinamide, while the efficiency levels were only 54.6% and 18.4% for NGT2-2.5 and NGT2-5, respectively. The application of 5 mM nicotinamide led to an extremely low transformation efficiency; therefore, this concentration should not be applied during wheat genetic transformation. [ijms-24-04416-f004] #### Table 5. ### 2.5. Application of Nicotinamide in Wheat Transformation for Improving Mutation Efficiency by Base Editing An expression vector, ABENG-Wx, was used for base editing in wheat genetic transformation to investigate the effects of nicotinamide application, with available concentrations, on the mutation efficiency of base editing. Since there were only two copies ofTaWaxygenes in Fielder on chromosomes 7A and 7D, another copy ofTaWaxy-7Bdid not need to be detected in the transgenic plants. As shown inTable 6, only one mutant was found in 30 transgenic plants in the control experiment (without nicotinamide treatment) and the efficiency of the target gene (by base editing) was only 3.3%. A total of six mutants were detected in the treatment experiment with 2.5 mM nicotinamide, and the editing efficiency was increased nearly threefold (9.7%). Moreover,TaWaxy-7AandTaWaxy-7Dwere found to be simultaneously edited in two mutants. The results of sequencing shown that all of mutations occurred at the 4th or 7th base of the sgRNA, only one transgenic plants have the mutation at both positions simultaneously (Figure 5). #### Table 6. [ijms-24-04416-f005] ## 3. Discussion ### 3.1. The Factors Affect the HDACi Treatment In fact, many factors influence the effect of HDACi treatment, listed as follows: (1) The types of HDACi. Sodium butyrate and nicotinamide were two kinds of HDACi. Bond et al. found that the expression of theVIN3gene inArabidopsiswas increased when the plants were exposed to sodium butyrate and nicotinamide, indicating that HDACi could relax chromatin [29]. It was also found that the pretreatment of maize cells with either sodium butyrate and nicotinamide had a positive effect on the efficiency of oligonucleotide-directed mutagenesis [27]. In the two chemicals, treatment with nicotinamide had a less severe effect on plant growth than sodium butyrate inArabidopsis[29]. Additionally, sodium butyrate has been proven to exert a negative effect on wheat tissues [28]. Therefore, it is better to treat wheat tissues using nicotinamide. (2) The concentration of nicotinamide. It was found that the effect of nicotinamide treatment at 5 mM is 2.5 fold higher than that at 2.5 mM inArabidopsis[29]. Moreover, when nicotinamide (1–5 mM) was used in maize cells, the editing efficiency enhanced with the increased concentration [27], while our results showed that the effect of 2.5 mM nicotinamide treatment on editing efficiency is optimal (Table 1andTable 2). (3) The time of nicotinamide treatment. The times normally influence the effect of nicotinamide treatment (Table 1andTable 5). In this study, we obtained the best editing results using nicotinamide to treat wheat tissues for 7 d (Table 1). (4) The tissues used for nicotinamide treatment. It was reported that the nicotinamide treatment showed a good effect on seedlings and cells [27,29]. In this study, the editing efficiency was proved to be improved by treating wheat callus, mature, and immature embryo with nicotinamide. (5) Species. Different plant species may also lead to different effects of nicotinamide treatment. (6) Other factors. In this study, the treatment effect of nicotinamide for theGUSgene is higher than that for theTaWaxygene. This might be caused by different sgRNA or even different insertion sites of transgenes which might lead to different expression of theCas9gene. ### 3.2. Application Prospects of Nicotinamide in Wheat for Efficient Genome Editing Although the editing efficiency of CRISPR is high in some diploid plants, it is still somewhat difficult to obtain mutants in which all the target allelic genes are simultaneously edited in polyploid plants. For example, in wheat, the editing efficiency reached 51.7% for the threeTaNudalleles as a whole but only 8.5% forTaNud-7Dalone [30]. When we edit some genes in wheat, there is no mutation, and generally we need to do transformation experiments again. In this study, we found that nicotinamide treatment can increase the editing efficiency to 36% from 0% (Table 1) in the next generation of non-edited transgenic plants. Therefore, nicotinamide treatment can be used to treat the non-mutation transgenic plants for obtaining the mutants, which saves time and cost. Normally, if there is only single chromosome mutation happening in different plants, crosses need to be made with each other for obtaining triple mutations. In this study, the efficiency of triple mutations was increased to 7.7% from 0% after nicotinamide treatment on single-chromosome mutations under optimal conditions (Table 3). Therefore, the application of nicotinamide treatment is an available choice for improving editing efficiency in wheat. Adenine base editors (ABEs) and cytosine base editors (CBEs) are two major developments in base editing tools. Recently, several evolved ABE8e systems have been reported to increase A-to-G editing efficiency in plants [31,32,33,34]. ABE8e were fused with SpCas9 nickase variants (SpCas9-NG) that recognized the PAM NGN to form ABE8e-NG and led to an average editing efficiency of 59.3% for the tested NGN target sites in rice [35]. In the present study, the editing efficiency of ABE8e-NG was only 3.33% in wheat, but it could be increased nearly threefold after nicotinamide treatment. Therefore, the effect of nicotinamide treatment on the editing efficiency by base editing is very positive. The prime editing (PE) system is another recent genome editing tool and the latest research hotspot. However, as of now, its efficiency is still very low [36,37]. The application of nicotinamide treatment might provide an effective strategy to improve the editing efficiency by PE system. Therefore, we assumed that nicotinamide treatment would have a great application potential for the editing of inefficient target sites in wheat using base editing and PE systems. ## 4. Materials and Methods ### 4.1. Plant Materials The plant materials used in this study included T1homozygous transgenic wheat line H29 in the genetic background of CB037 which carried an activeGUSgene (called first time transformation), T1transgenic plants of non-mutatedGUScontainingCas9and the sgRNA forGUSin the genetic background of H29 (called second transformation), and T0transgenic plants transformed with pMWB110-SpCas9-TaU3-Waxy vector in the genetic background of Ningchun4 for nicotinamide treatment using their immature embryos, in which the target genes were not edited or partially edited. The aforementioned materials were obtained from our previous study [8]. Additionally, a spring wheat cultivar, Fielder, maintained in our group was also used to study the influence of nicotinamide treatment on callus growth and transformation efficiency. All the plants were grown in pots in a growth chamber maintained at 24 °C under 16/8 h light/dark conditions with 300 μmol m−2s−1light intensity and 45% humidity. The immature embryos of the T0transgenic plants were treated with nicotinamide, and their mature embryos from the harvested seeds of no-edited plants were treated with nicotinamide again. Then, the effects of nicotinamide treatment on subsequent editing efficiency were investigated. ### 4.2. Design of Wheat Mature and Immature Embryos with Nicotinamide Treatment About 14 days post-anthesis (DPA), the immature wheat grains were sampled, sterilized with 70% ethanol for 1 min and 15% sodium hypochlorite for 10 min and then washed three times with sterile water. The immature wheat embryos were isolated and cultured on 1/2 MS medium (2.215 g L−1MS powder, 20 g L−1sucrose, 0.5 g L−1MES, and 3 g L−1phytagel, pH 5.8) with two concentrations of nicotinamide (2.5 and 5.0 mM, N0636, Sigma, Louis, MO, USA) at 2, 7, and 14 d in order as well as a non-treated control in which the germinated embryos in the treatments with nicotinamide for 2 and 7 d were promptly moved onto the control medium for a total culture period of 14 d. Then, the plantlets were transplanted into pots with soil for further growth. The mature wheat grains were surface sterilized with 70% ethanol for 1 min and with 15% sodium hypochlorite for 20 min, washed with sterile water three times, and then immersed in sterile water before being placed in a shaker overnight. The slightly germinated seeds were sterilized with 15% sodium hypochlorite for 20 min and washed with sterilized water three times. The mature embryos were separated from the seeds and cultured on 1/2 MS medium with nicotinamide at the same levels and time intervals above. ### 4.3. Detection of Mutations Genomic DNA was extracted from the leaves of candidate wheat mutant plants using a Nuclean Plant Genomic DNA Kit (CW0531M, CWBIO, Jiangsu, China). The specific primers were used to amplify the targeted genes ofbar,GUS,andTaWaxy, in order (Supplementary Table S1). In order to confirm that the candidate plants contained the genome editing cassette, thebargene was detected first. Then, the PCR-restriction enzyme (PCR-RE) method was applied to detect the mutants, in which the specific PCR products were digested at 37 °C for 2 h in the 20 μL reaction buffer consisted of the corresponding restriction enzymes (1 U each) and 10 μL PCR products. The restriction enzymes ofSnaBIandBglIIwere used to detect theGUSandTaWaxygene mutants, respectively. The resultant products were separated in a 1% agarose gel and visualized using a GelDoc XR System (BioRad, Hercules, CA, USA). Three types of band patterns were found in the PCR-RE assay; heterozygous monoallelic mutants gave three bands, biallelic mutants gave only the largest band, and nonmutants and wild-type (WT) plants gave two completely digested bands. The PCR products were directly sequenced at Sangon Biotech (Shanghai, China) for analysis of the mutations induced by base editing. ### 4.4. Base Editing Vector Construction The pWMB110-SpCas9 containing the bar gene as a selection marker for generating transgenic plants and the maize (Zea mays) ubi promoter for driving the expression ofCas9gene had previously been constructed by our laboratory [8]. The sequences of ABE8e and SpCas9-NG [35] were optimized based on the wheat genome sequencing data and then inserted the pMWB110-SpCas9 vector to replace the SpCas9. In order to increase the transformation efficiency, a regeneration-related gene, TaWOX5, was introduced into the base editing vector to generate the pMWB110-ABE-NG-TaWOX5 plasmid [38]. The sgRNA1 (AAGACCAAGGAGAAGATCTA) and sgRNA2 (CTGGATGAAGGCCGGGATCCTGC) were designed onhttps://crispr.bioinfo.nrc.ca/WheatCrispr/, (accessed on 21 February 2023) based on the sequences ofTaWaxygenes for base editing, and then the sgRNA controlled by TaU3 promoter was constructed onto plasmid pMWB110-ABE-NG-TaWOX5 to generate ABENG-Wx and NGT2 vectors according to the method described by Liu et al. [8], respectively. The base editing vector was transformed intoAgrobacteriumstrain C58C1 for wheat transformation. ### 4.5. Wheat Transformation Immature wheat embryos were isolated and underwentAgrobacterium-mediated transformation to obtain transgenic plants following the protocol described by Wang et al. [38]. In brief, immature wheat embryos were incubated withAgrobacteriumstrain C58C1-harboring a transformation vector for 5 min in WLS-inf medium (1/10 Linsmaier and Skoog (LS) salts, 1/10 Murashige and Skoog (MS) vitamins, glucose 10 g L−1, 2-(N-morpholino) ethanesulfonic acid (MES) 0.5 g L−1, and acetosyringone (AS) 100 μM, pH 5.8) at room temperature and co-cultivated for 2 d on WLS-AS medium (WLS-inf medium plus AgNO30.85 mg L−1, CuSO4·5H2O 1.25 mg L−1and agarose 8 g L−1) with scutellum facing upwards at 25 °C in darkness. After co-cultivation, embryonic axes were removed with a scalpel, and the scutella were transferred onto plates containing WLS-Res medium (LS salts, MS vitamins, 2,4-d 0.5 mg L−1, picloram 2.2 mg L−1, AgNO30.85 mg L−1, ascorbic acid 100 mg L−1, carbenicillin 250 mg L−1, cefotaxime 100 mg L−1, MES 1.95 g L−1, and agarose 5 g L−1) for delay culture for 7 d with different nicotinamide concentrations. Afterward, the tissues were moved onto WLS-P5 medium (WLS-Res medium plus phosphinothricin (PPT, Sigma, no. 45520) 5 mg L−1without cefotaxime) for callus induction. Two weeks later, the calli were shifted onto WLS-P10 medium (WLS-Res medium plus PPT 10 mg L−1without cefotaxime) for 3 weeks in darkness. The embryogenic calli were then differentiated on LSZ-P5 medium (1/2MS medium containing PPT 5 mg L−1) at 25 °C with 100 μmol/m2/s light. The regenerated shoots were transferred into cups filled with LSF-P5 medium (LSZ-P5 medium plus IBA 1 mg L−1) for elongation and root formation. The plantlets with well-developed root systems were transplanted into pots and cultivated in a growth chamber. ## Acknowledgments The authors are grateful to all lab members for encouragement. We are grateful to Wenxue Li at the Institute of Crop Science, Chinese Academy of Sciences, China, for the help on the manuscript. ## Supplementary Materials The supporting information can be downloaded at:https://www.mdpi.com/article/10.3390/ijms24054416/s1. ## Author Contributions K.W. and C.Z. designed the project. K.W. and X.Y. conducted the experiments. W.W., P.H., W.D., H.T., Y.Q., Y.C., Z.H., X.L. and L.D. participated in some experiments. W.W., P.H. and W.D. analyzed the data and wrote the manuscript. K.W. and X.Y. revised the manuscript. All authors have read and agreed to the published version of the manuscript. ## Institutional Review Board Statement Not applicable. ## Informed Consent Statement Not applicable. ## Data Availability Statement The data presented in this study are available in the article andsupplementary material. ## Conflicts of Interest The authors declare no conflict of interest. ## Funding Statement This research was supported by the National Natural Science Foundation of China (31871710 and 31971946), the Agricultural Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (S2022ZD03), and the Chinese Academy of Agricultural Sciences in China (2060302-2-19). ## Footnotes ## References ## Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. ### Supplementary Materials ### Data Availability Statement The data presented in this study are available in the article andsupplementary material.	[ "Wanxin Wang", "Peipei Huang", "Wenshuang Dai", "Huali Tang", "Yuliang Qiu", "Yanan Chang", "Zhiyang Han", "Xi Li", "Lipu Du", "Xingguo Ye", "Cheng Zou", "Ke Wang" ]	International Journal of Molecular Sciences	10.3390/ijms24054416	36901844	5	5	1,855	28,754
PMC10002423	Unveil the Secret of the Bacteria and Phage Arms Race	Bacteria have developed different mechanisms to defend against phages, such as preventing phages from being adsorbed on the surface of host bacteria; through the superinfection exclusion (Sie) block of phage’s nucleic acid injection; by restricting modification (R-M) systems, CRISPR-Cas, aborting infection (Abi) and other defense systems to interfere with the replication of phage genes in the host; through the quorum sensing (QS) enhancement of phage’s resistant effect. At the same time, phages have also evolved a variety of counter-defense strategies, such as degrading extracellular polymeric substances (EPS) that mask receptors or recognize new receptors, thereby regaining the ability to adsorb host cells; modifying its own genes to prevent the R-M systems from recognizing phage genes or evolving proteins that can inhibit the R-M complex; through the gene mutation itself, building nucleus-like compartments or evolving anti-CRISPR (Acr) proteins to resist CRISPR-Cas systems; and by producing antirepressors or blocking the combination of autoinducers (AIs) and its receptors to suppress the QS. The arms race between bacteria and phages is conducive to the coevolution between bacteria and phages. This review details bacterial anti-phage strategies and anti-defense strategies of phages and will provide basic theoretical support for phage therapy while deeply understanding the interaction mechanism between bacteria and phages. Keywords:bacteria, phages, restricting modification systems, CRISPR-Cas systems, aborting infection, quorum sensing	## 1. Introduction Bacteria and bacteriophages (phages for short) have been engaged in a constant and repeated arms race and have coexisted steadily for billions of years. Phages outnumber bacteria by ten to one and are widely recognized as the most diverse of microbes. Phages can be divided into temperate phages and lytic phages according to their intracellular proliferation modes [1]. After infecting the host, temperate phages do not lysis the host cell but remain in the lysogenic state, integrating the phage genome into the host genome, becoming prophage and replicating with the host replication. Lytic phages can cause lysis and death of the host [2]. The process of lytic phages infecting the host includes five parts: adsorption, injection, biosynthesis, assembly and release. Under certain conditions, temperate phages can enter the lysis cycle from the lysogenic state, causing the host cell to the lysis and die [3]. Bacteria have developed various strategies to resist phage infection, such as preventing phages from adsorbed on the surface of bacteria [4]; through the superinfection exclusion (Sie) block of phage’s nucleic acid injection [5]; by restricting modification (R-M) systems [6], CRISPR-Cas [7], aborting infection (Abi) [8] and other defense systems to interfere with the replication of phage genes in the host; and through quorum sensing (QS) enhancement of phage’s resistant effect [9]. At the same time, phages have also evolved a variety of counter-defense strategies, such as degrading extracellular polymeric substances (EPS) that mask receptors [10] or recognizing new receptors [11], thereby regaining the ability to adsorb host cells; modifying its genes to prevent the R-M systems from recognizing phage genes [12] or evolving proteins that can inhibit the R-M complex [13]; through mutate the target sequence [14], build nucleus-like compartments [15] or evolved anti-CRISPR (Acr) proteins [16] to resist CRISPR-Cas systems; and by producing antirepressors [17] or blocking the combination of autoinducers (AIs) and its receptors [18] to suppress the QS (Table 1). ### Table 1. The competition between bacteria and phages has never stopped, and the rapid co-evolution between them has a positive impact on improving the evolution rate of phages and bacteria [19]. Understanding these adversarial strategies is of great significance to the research fields of practical applications. ## 2. Bacterial Anti-Phage Strategies ### 2.1. Blocking Phage Adsorption Preventing phages from attaching to host cells is the first step in the bacterial defense battle. Strategies to avoid phage adsorption can be divided into two categories: (i) loss or structural change of receptors and (ii) construction of physical barriers to phage infection. The absence of receptors is a key part of bacterial resistance to phage infection [20] (Figure 1a). [ijms-24-04363-f001] Through gene mutation or deletion, the receptor cannot be expressed or the structure of the receptor can be changed to protect bacteria from phage infection. For example, phage OWB uses tail tubular proteins A and B to recognize the transmembrane protein encoded byVibrio parahaemolyticus vp0980. However, due to the lack of phage-recognized receptors, the mutant hindered the adsorption of phage OWB [4].Listeria monocytogenesserovar 4b is mutated from serotype 4b to the more virulent serotype 4d by mutating the gene encoding the glycosylation of teichoic acid. Serotype 4d is resistant to infection by phages with wall-teichoic acids as recognition receptors due to the absence of galactose from wall-teichoic acids and lipoteichoic acid molecules [21]. The cell wall is usually thought to protect bacteria from environmental threats [22]. However, because the cell wall contains receptors that the phages can recognize, bacteria with cell wall defects can resist phage adsorption in some cases. Cell wall deficiency is one of the mechanisms of bacteria hindering phage adsorption [23]. By losing or modifying the receptors of jumbo phages, such as lipopolysaccharide and type IV pili, the adsorption of phages toPseudomonas aeruginosa(P. aeruginosa) PA5oc can be inhibited [24]. At the same time, the virulence and pathogenicity of the bacteria are reduced due to the reduction in the virulence factors such as lipopolysaccharide and type IV pili. In addition, studies have shown that some phage-resistant mutant strains can also affect the growth of bacterial biofilm. The PA1S_08510 gene ofP. aeruginosaPA1 strains encodes the O-antigen polymerase Wzy. The phage-resistant mutant strain PA1RG hinders the infection of phage PaP1 which uses O-antigen as a receptor due to the lack of O-antigen on its surface [25]. Meanwhile, the reduction in biofilm in the mutant strain PA1RG can lead to the re-sensitivity of drug-resistant bacteria to some antibiotics. The capsule (K antigen), which acts as a virulence factor, can also act as a receptor for some phages. Phages ΦFG02 and ΦCO01 are able to infectAcinetobacter baumannii(A. baumannii) strains AB900 and A9844, respectively, using the capsule as receptors. The phage-resistant mutants ΦFG02-RAB900 and ΦCO01-RA9844 affected the genes responsible for capsule biosynthesis,gtr29andgpi, respectively, through a single nucleotide deletion at the K locus. The deletion of the capsule as phage receptors, ΦFG02-RAB900 and ΦCO01-RA9844, results in the interruption of phage adsorption [26]. Phage Phab24 also uses the capsule ofA. baumanniias receptors and the outer membrane as secondary receptors [27]. Besides, both studies have found that phage-resistant mutants lacking bacterial capsules can be re-sensitized to antibiotics, which is conducive to the study of phage therapy and phage therapy in combination with antibiotics for the treatment of drug-resistant bacteria. Masking phage receptors by physical barriers such as outer membrane vesicles (OMVs) or EPS can also prevent phages from being adsorbed to bacterial surfaces. Composed of polysaccharides, proteins and nucleic acids, EPS not only enables bacteria to survive in harsh environments but is also significant in fighting against attacks on bacteria by phages and antibiotics [28,29]. The outer membrane protein OmpA ofEscherichia coli(E. coli) has been proven to be the receptor of some T-even-like phages. The outer membrane lipoprotein TraT interacts with OmpA to inhibit OmpA-specific phages binding to the receptors and thus inhibit phage adsorption [30]. The cell-binding protein A ofStaphylococcus aureus(S. aureus) can also mask teichoic acid which acts as the phage receptor and achieve inhibition of adsorption [31]. There are various types of OMVs secreted by bacteria, which have functions such as transporting virulence factors and bacterial communication [32]. In addition, OMVs can also act as a protective umbrella for bacteria, hindering phage’s adsorption to bacterial surface receptors. The phage infection can be effectively avoided by allowing phages to attach to OMVs [33]. ### 2.2. Blocking Phage’s Injection Blocking the injection of phage nucleic acids through Sie is the second line of defense established by bacteria. Sie exists widely in animal [34] and plant viruses [35]. Sie prevents the host cell infected by the temperate phages from being infected again by identical or highly similar phages. Various proteins encoded by phages establish the Sie mechanism by (i) inhibiting phages from binding to receptors, (ii) blocking phage’s DNA injection, and (iii) inhibiting phage tail tube penetration of the plasma membrane [36]. The protein gp05 encoded by temperate phage D3112 is a twitching inhibitory protein that affects the assembly of type IV pilus tail fiber proteins (TFPs) by interacting with the bacterial type IV pilus assembly protein PilB. Thus, preventing phage MP22, which also usesP. aeruginosaTFPs as receptors, from re-infecting the host cell [37] (Figure 2). T-even phages can establish the Sie mechanism after infecting bacteria. For example, when other T-even phages re-infect the host, the T4 phage encodes two proteins, Imm and Spackle, that enable about 50% of the DNA to remain in the head of the phage and the rest to be degraded by endonuclease I in the peripheral space of the host cell, thus preventing the injection of the phage’s DNA into the bacteria [5]. Among them, Imm blocks DNA transfer into the cytoplasm by binding to the receptor on the inner membrane. Spackle blocks the degradation of peptidoglycan. The early phage gene product Sp inhibits the activity of gp5 by forming the Sp-gp5 complex with the phage tail spike protein gp5, hindering the local degradation of host cell peptidoglycan by the lysozyme, and preventing the phage’s tail from entering the cytoplasm. In addition, studies have shown that Sp does not interact with T4 endolysin. On the one hand, the structure of endolysin is different from that of gp5; on the other hand, as a late gene product, endolysin seems more difficult to interact with Sp [38]. Since lytic activity in T4 is not significantly inhibited, host cells containing prophages can still be lysed and release progeny phage particles. Sie has been extensively studied in double-stranded DNA (dsDNA) phages, while single-stranded DNA (ssDNA) phages belonging to the familyMicroviridaehave also been proven to block a phage’s DNA injection through the highly variable region of the DNA pilot protein, thus preventing the repeated infection of other microviruses [39]. [ijms-24-04363-f002] The antisense RNA of some phages can regulate the expression of Sie-related genes, thus affecting the mechanism of Sie action. In the lysogenic state, the genesieBof temperate phage P22 encodes two peptides, namely, the exclusion protein SieB and Esc. The exclusion protein SieB mediated the Sie mechanism, and Esc inhibited SieB. However, since the antisense RNA synthesized by phage P22 has an inhibitory effect on SieB synthesis, and the regulatory genesieBselectively expresses Esc, P22 still has a chance to re-infect the host cell, thus escaping the Sie mechanism [40]. ### 2.3. Interfering with Phage Replication Blocking the replication of phage nucleic acid in host cells is the third line of defense that bacteria have established. Currently, well-studied defense systems include (i) R-M systems, (ii) CRISPR-Cas adaptive immune systems, and (iii) Abi. In addition, some emerging defense systems are being discovered. Here, several anti-phage defense systems widely distributed in bacteria are introduced in detail. At the same time, the newly discovered defense systems in recent years are briefly listed to enrich the understanding of the mechanism of bacterial anti-phage action. #### 2.3.1. Restriction-Modification Systems R-M systems are the classical defense system that interferes with the replication of phages in the host, which generally acts in the early stage of phage infection. R-M systems can be classified into four classes (I–IV) [6], among which, type II R-M systems have been the most widely studied. The type I–III R-M system consists of genes encoding restriction endonuclease (REase) and methyltransferase (MTase), while the type IV R-M system contains only REase-related genes. MTase methylates its own DNA recognition site to distinguish unmodified foreign DNA, and REase cleaves the phosphodiester bond of unmethylated foreign phage DNA (Figure 3a). In addition, R-M systems rely on mobile genetic elements to promote bacterial genome evolution through horizontal gene transfer [41,42]. The REase and MTase of the type I R-M system are composed of three subunits, HsdR (DNA-restricted translocation subunit), HsdM (DNA-modified subunit), and HsdS (DNA-specific subunit) encoded by the host-specific determining factor (hsd) gene [43], while the REase of type II R-M system is composed of a single subunit. [ijms-24-04363-f003] However, sometimes the R-M systems can lead to the cleaving of its DNA due to false recognition, thus causing autoimmunity [44]. In addition, when the expression of REase and MTase is unbalanced, it can be fatal. When the REase/MTase ratio is too high, the host’s DNA may be cleaved by REase before it is methylated. In contrast, when the REase/MTase ratio is too low, phage DNA is modified by MTase and cannot be cleaved by REase, resulting in the host being infected. After the transformation ofE. colicells with plasmids carrying the Esp1396I type II R-M system, MTase is first synthesized to rapidly modify bacteria genome in order to avoid cleavage of the host DNA by the synthesized REase [45]. On the one hand, the promoter of MTase gene transcription is stronger than that of REase; on the other hand, because type II REase needs to be active in the form of homologous dimer or homologous tetramer, low concentration of gene expression products will limit the formation of polymerization. At present, one of the regulatory mechanisms of type II R-M system expression is dependent on the C protein. Transcription factor C protein in C-dependent R-M systems can regulate the expression levels of REase and MTase and may play different regulatory roles in different R-M systems [46]. The binding site of the C protein, C-box, consists of a pair of reverse repeats that form a negative feedback loop with the C protein homologous dimer. When the C protein concentration is low, the expression of downstream REase is activated. On the contrary, REase expression was inhibited when C protein concentration was high. Although a low concentration of C protein can activate downstream REase expression, the tandem REase promoter still plays a dominant role in the expression of REase gene [47]. C protein is conducive to the expression of MTase before REase, and the absence of the C gene will lead to the premature expression of REase, resulting in REase cleaving of its DNA [48]. #### 2.3.2. CRISPR-Cas Adaptive Immune Systems The CRISPR-Cas systems defend against phages by recognizing and cleaving phage genes [49]. Moreover, some CRISPR-Cas systems can still exert immunity against methylated phage DNA [50]. CRISPR-Cas are widespread in bacteria, such as the type I-E CRISPR-Cas system found inE. coliK12 [7], the type II CRISPR-Cas system found inStreptococcus agalactiae(S. agalactiae) strain GD201008-001 [51], the type I-C CRISPR-Cas system found inActinomycetes Eggerthella lenta[52]. CRISPR-Cas systems are of great significance for the evolution of bacteria and for enhancing the adaptability of bacteria to the environment [53]. The process of CRISPR-Cas systems to play an immune role can be divided into three steps: adaptation (acquisition of foreign genes), expression (transcription of CRISPR array, maturation of transcripts and formation of effector complexes), and interference (targeting and cleavage of foreign genes) (Figure 4a). Spacers of the CRISPR-Cas systems are generally obtained at the early stage of phage genes injection into host cells [54]. The CRISPR-Cas systems can insert phage genes (protospacer) into CRISPR sites on the host genome. Different phages protospacer inserts into the bacterial genome constitute rich and diverse spacers in the host genome. The more types of phages that infect the host and the more diverse the spacers, the more beneficial it is for bacteria to defend against infection by different phages [55]. In addition to Cas proteins, the trans-activating CRISPR RNA (tracrRNA), which is partially complementary to crRNA, is also essential in the processing of CRISPR-derived RNA (crRNA) from precursor crRNA (pre-crRNA) [56]. The crRNA and tracrRNA are called guide RNA (gRNA). The gRNA and Cas proteins form the effector complex to target and cleave phage nucleic acids. TracrRNA has only been found in type II and V-B systems, and effector complexes of other CRISPR-Cas systems consist only of crRNA with Cas proteins. [ijms-24-04363-f004] The protospacer adjacent motif (PAM) of the CRISPR-Cas systems is located near the protospacer. On the one hand, PAM can assist the Cas protein to recognize foreign genes more accurately and avoid causing host autoimmunity. On the other hand, PAM also provides the possibility for phage point mutations to escape the CRISPR-Cas systems. In addition, crRNA terminal sequences can distinguish host genes by recognizing repeats (about 8 bp) in CRISPR sequences, thereby protecting host genes from cleavage [57]. Nevertheless, the phenomenon of self-targeting spacers still occurs sometimes, and the CRISPR-Cas system mistakenly targets and cuts its own genome, leading to the occurrence of autoimmunity [58]. According to the composition of Cas proteins in effector complexes, CRISPR-Cas systems can be classified into class 1 systems (consistsing of multiple Cas proteins) and class 2 systems (consisting of a single Cas protein) [59]. Each type is further divided into multiple subtypes. Different Cas proteins play different roles, such as the integration of foreign DNA, the maturation of crRNA and the cleavage of foreign genes [60,61]. Cas12a protein in type V CRISPR-Cas acts as the RNase to process pre-crRNA into crRNA, and Cas13 in type VI CRISPR-Cas can play the function of targeting and cleaving single-stranded RNA (ssRNA) [62]. Some Cas proteins play a single role, while some Cas proteins can have multiple functions at the same time. For example, Cas9 plays an indispensable role in all stages of the type II CRISPR-Cas system defense against phages [63]. Obviously, the more phage species, the more abundant and diverse spacers in the host genome, which is more conducive to the evolution of bacterial CRISPR-Cas systems. Additionally, the higher the content of CRISPR spacers, the more sensitive the bacteria to phages [64]. The increase in phage abundance is conducive to the increase in CRISPR-Cas systems abundance. Additionally, when the abundance of phages is constant, the phage species is inversely correlated with the abundance of CRISPR-Cas systems [65]. In addition to phage diversity, bacterial species richness can also have an impact on the evolution of CRISPR-Cas systems. When there are infectious phages in the environment, the more intense the competition between bacterial species is and the more beneficial the anti-phage evolution of bacterial CRISPR-Cas is [66]. Moreover, when there are abundant bacterial species and strong interspecific competition in the environment, bacteria will preferentially adopt CRISPR-Cas rather than surface receptor mutation to defend against phage infection [66]. The acquisition rate of spacers has also been shown to be one of the decisive factors affecting the abundance of spacers. The faster CRISPR-Cas can obtain spacers, the more conducive it is to increaseing the diversity of spacers [67]. In addition, the speed of phage development is also one of the important factors affecting the evolution of bacterial CRISPR-Cas systems. When phages develop too fast in the host cell, it is not conducive for the host to acquire spacers [68]. When the host growth is stagnant, the growth rate of phages in the host is delayed, but the acquisition process of spacers is not affected at this time. Therefore, when the host cell growth is inhibited by the external environment and thus inhibits the speed of phage growth, the evolution of the CRISPR-Cas systems may be beneficial. #### 2.3.3. Abortive Infection The Abi immune systems are activated during the middle and late stages of phage maturation. By inhibiting their own metabolism, bacteria lead to their own growth arrest and eventually lead to the death of bacteria, thus avoiding the maturation and release of phages. Although Abi can prevent other bacteria from being infected by mature progeny phages, it is at the cost of host cell suicide, so Abi can also be considered as the last line of defense of the bacterial anti-phage mechanism. Abi can impede phage replication based on (i) CRISPR-Cas systems (Figure 5a), (ii) toxin-antitoxin (TA) systems (Figure 5b), and (iii) cyclic oligonucleotide-based anti-phage signaling system (CBASS) [8] (Figure 5c). This part will introduce the Abi immune systems from three aspects: CRISPR-Cas, TA and CBASS. [ijms-24-04363-f005] When phages infect host cells and CRISPR-Cas fails to provide good protection to bacteria, they may choose to mediate Abi to protect other uninfected cells by sacrificing themselves [69]. For example, type I-F CRISPR-Cas ofPectobacterium atrosepticuminhibits the maturation of the lytic phages ΦTE and ΦM1 by mediating Abi [70]. This may be caused by the indiscriminate cleavage of CRISPR-Cas’s own genes, but the specific mechanism of Abi caused by type I-F CRISPR-Cas is still unclear. For example, both Cas14 and Cas12 with a single RuvC domain can nonspecifically target ssDNA [71], and Cas13 can nonspecifically target ssRNA. In fact, the Cas protein with endonuclease activity, which nonspecifically targets phages and bacterial genes, is thought to be one of the causes of CRISPR-Cas mediated Abi. The TA systems can also mediate the Abi immune systems and block phage infection. TA systems also have a variety of functions such as controlling bacterial growth, biofilm formation, maintaining genome stability, and dormancy [72]. This part mainly introduces its function of resisting phage infection. TA systems are widespread in bacteria and consist of toxins and less stable antitoxins. Among them, toxins usually play the role of inhibiting bacterial growth in the form of protein, and antitoxins play the role of inhibiting toxins in the form of protein or RNA [73]. TA systems are divided into six types (Type I–Type VI. The phage activation mechanism of TA systems is not fully clear. At present, a relatively clear molecular mechanism is considered [74]: under normal circumstances, antitoxins can play a role in inhibiting toxins. At this point, the toxin is neutralized, and the TA systems are not activated. However, when phages infect bacteria, the TA transcription function of bacteria is hindered, and unstable antitoxin is degraded before toxin, resulting in toxin accumulation, which leads to bacterial growth arrest or death. Type I TA system toxins (<60 aa) can hinder the synthesis of ATP or act as a nonspecific endonuclease to cleave methylated and unmethylated DNA without distinction, thereby retarding bacterial growth or causing bacterial death [75]. For example, the toxin RalR in the type I TA system ofE. colimediates bacterial death by indiscriminate DNA cleavage, while the antitoxin RalA blocks the translation of toxin proteins by complementary pairing with the mRNA guiding RalR synthesis [76]. The type I TA system Hok/Sok can inhibit phage T4 infection. Phage T4 can block the host transcription process and the antitoxin Sok is not stable. As a result, Sok is degraded first and the toxin Hok is activated, thus inhibiting the growth of host cells [77]. Antitoxins forming complexes with toxins is one of the common ways in the type II TA system that toxins mediate Abi systems by cleaving mRNA as RNase to inhibit bacterial protein synthesis [78,79]. The toxin RnlA in the type II TA system has RNase activity, and the toxin RnlA exists as a homodimer with two conformations [80]. The antitoxin RnlB inhibits RnlA by binding to the HEPN (higher eukaryotes and prokaryotes nucleotide) domain of the toxin RnlA. The antitoxin (the form of RNA) of type III TA interacts with toxins directly to inhibit the toxin [81]. Phage T4 can inhibit the transcription of toxin ToxN and antitoxin ToxI in the type III TA system afterE. coliinfection. Because antitoxin ToxI is more unstable than toxin ToxN, a large amount of ToxN is accumulated [74]. The toxin ToxN, which acts as an RNase, inhibits phage translation and maturation mainly by recognizing the GAAAU motif and cleaving the mRNA of the phages. When no phages infect bacteria, the ToxI pseudoknot with a sequence length of 36 nt interacts with three ToxNs to form a complex, thereby inhibiting the activity of ToxN [82]. The antitoxin (the form of protein) of type IV TA systems binds to the target of action of the toxin rather than forming a complex with the toxin protein. For example, in the type IV TA system ofS. agalactiae, the antitoxin AbiEi inhibits the binding of the toxin AbiEii, which acts as a nucleotidyltransferase (NTase) to GTP [83]. The antitoxin GhoS of the type V TA system can specifically recognize and cleave the U- and A-rich sites in the mRNA of toxin GhoT, thus hindering the dissolution of the cell membrane by GhoT [84]. Different from the TA systems found in the past, in the type VI TA system, the toxin SocB, which can bind to the sliding clamp to hinder the replication process, can be degraded by the protease ClpXP with the participation of the antitoxin SocA [85]. Moreover, the type I TA system inClostridium difficile(C. difficile) co-localizes with CRISPR arrays [86]. This means that CRISPR-Cas and TA systems may have some potential connection in mediating Abi. In addition, CBASS is also one of the ways to mediate bacterial Abi. The CBASS immune system is widespread in bacteria and can impede phage replication. After a phage infection, cGAS/DncV-like nucleotide transferase (CD-NTases) in bacterial CBASS can synthesize second messengers such as cyclic dinucleotides and cyclic trinucleotides [87]. The CD-NTase-related protein Cap, which acts as an effector protein, is activated after binding to specific second messengers and induces cell death by disrupting cell membranes, cleaving intracellular DNA, or other means. The crystal structure of the Cap protein can determine the type of the second messenger that binds to it [88]. AfterYersiniais infected by phages, the receptor domain of oligomeric cyclic dinucleotide formed by the 8-stranded β-barrel scaffold specifically binds to signaling molecules (second messengers) to promote a bacterial inner membrane rupture and mediate bacterial death [89]. Cyclic AMP-AMP-AMP (cAAA) can also induce bacterial death after binding to the homotrimer DNA endonuclease NucC (nuclease, CD-NTase-associated) in CBASS. NucC can induce bacterial death by cleaving intracellular DNA, thereby hindering phage replication in the cell. In addition, the combination of cAAA with the triple symmetric allosteric pocket of NucC can promote the formation of NucC homohexamer, which also has DNA cleavage activity [90]. Cap4 inEnterobacter cloacae(E. cloacae) can form a SAVED domain by the fusion of two CARF (CRISPR-associated Rossman fold). After specifically binding 2′-5′- and 3′-5′ -linked cyclic oligonucleotide signals, the SAVED domain activates the dsDNA endonuclease activity of Cap4, and then cleaves intracellular DNA, thereby hindering the viral replication process [91]. CBASS can be divided into four types according to different cyclase genes, auxiliary genes (cap) and signaling molecules [92]. Type I CBASS (42%) had nocapgene and induced bacterial death by forming small holes in the bacterial membrane; type II CBASS (39%) containedcap2andcap3genes; type III CBASS contained three auxiliary genes:cap6(encoding TRIP13/Pch2 domains),cap7(encoding a single HORMA domain) andcap8(encoding two HORMA domains); type IV CBASS containscap9–11gene, which is small in quantity and it is not clear whether type IV CBASS can resist phage infection. Among them, the HORMA domain in type III CBASS can form HORMA complexes that can synthesize signaling molecules after binding with CD-NTases [93]. Additionally, TRIP13 ATPase can exert a negative regulatory effect by decomposing the HORMA complex. ### 2.4. Quorum Sensing The aforementioned mechanisms that hinder phage adsorption, injection and replication are all introduced from the level of individual bacteria. In addition, bacteria can also be regulated as a group through QS [94]. QS, which has the function of intercellular communication, is composed of quorum-sensing signal synthase, extracellular signaling molecules called AIs and receptors [95]. AIs synthesized by quorum-sensing signal synthase can play a role in regulating population density [96], regulating virulence factors [97] and resisting phage infection after binding with the corresponding receptor. The ways of QS resisting phage infection can be divided into two: (i) cooperating with CRISPR-Cas systems to stimulate the expression ofcasgenes [98] or promoting the identification and cleaving of target genes [9]; (ii) inhibiting phage adsorption by directly reducing phage receptors. Under the condition of high population density, the QS system can enhance the recognition and cleavage of phage genes by CRISPR-Cas systems [99]. For example, under the condition of high population density, the QS ofP. aeruginosaPA14 can promote the expression ofcasgene-encoding nuclease [98]. The smaI/smaR-type QS system can also enhance the immunity of CRISPR-Cas systems to phages in Serratia under the condition of high population density [100]. The quorum sensing signal synthase smaI can synthesize the acyl-homoserine lactones (AHL) signaling moleculeN-butanoyl-L-homoserine lactone (C4-HSL). When the host population density is high, C4-HSL increases. C4-HSL can bind to its receptor smaR, thus blocking the inhibition ofcasgene by DNA-binding repressor smaR (Figure 6a). In addition, the smaI/smaR-type QS system can also promote the ability of type I-E and I-F CRISPR-Cas systems to capture spacers, thus enhancing the adaptability of CRISPR-Cas systems. Thus, at high host population densities, the facilitation of the CRISPR-Cas system by the QS system may be aimed at reducing the adaptive cost of bacterial resistance to phages. [ijms-24-04363-f006] QS can directly reduce phage adsorption receptors to hinder phage adsorption. For example, the binding of AHL inE. coliwith its receptor SdiA can reduce phage λ receptor LamB and hinder phage adsorption [101] (Figure 6b). In addition, the QS system can also increase the biofilm of bacteria under the condition of low cell density [102] (Figure 6c). The increase in biofilms may be beneficial for masking phage receptors. However, the use of biofilms to mask receptors or to reduce the number of receptors does not seem to be the main way for the QS system to defend against phages. Under the condition of high population density, biofilm production may be inhibited rather than promoted by the QS system [103]. ## 3. Anti-Defense Strategies of Phages ### 3.1. Regaining the Ability to Identify and Adsorption Host Bacteria can block phage adsorption by disabling the expression of the receptor, changing the structure of the receptor or masking the receptor with a physical barrier formed by EPS. Given the mechanism of bacteria hindering phage adsorption, phages can (i) recognize new receptors or (ii) degrade EPS by depolymerase [10], and then acquire the ability to recognize and adsorb the host again (Figure 1b). Receptor binding protein (RBP) J is the host-recognizing trimer protein. Phage λ originally recognized the LamB receptor of hostE. coliby the J protein. However, when phage λ is co-cultured withE. colilacking the LamB receptor, phage EvoC, which recognizes the new receptor OmpF, can be isolated [11]. Additionally, both OmpF and LamB are trimeric structures. The RBP mutation of phages is not only an anti-defense measure against bacteria but is also conducive to the expansion of the host selection range of phages [104]. In addition, phages can also degrade EPS through depolymerase and acquire the ability to recognize the receptor. Depolymerases are divided into lyases (water-free molecules after the substrate is cleaved) and hydrolases [105]. Depolymerase is widely found in phages. For example,A. baumanniiphage IME200 can express the depolymerase Dpo48 [106], and phage IME205 can express the depolymerases Dpo42 and Dpo43 [107]. Phage Sb-1 can degrade the EPS of methicillin-resistantS. aureus. Furthermore, the lack of EPS protection can increase the sensitivity of bacteria to antibiotics [108]. Therefore, phage depolymerase can not only enhance the recognition ability of the host but also be used in combination with antibiotics as a new type of antibiotics [109]. ### 3.2. Anti-Defense Strategies for R-M Systems Aiming at the cleavage of unmethylated phage genes by bacterial R-M systems, phages (i) modify their own genes to block the cleavage of phages nucleic acids by REase (Figure 3b) or (ii) evolve the overcome classical restriction (Ocr) protein and the restriction of DNA A (ArdA) protein that can inhibit the R-M complex (Figure 3c). Gene modification is one of the ways that phages resist the R-M systems. For example, phages T4gt, T4, Xp12, and SP8 modify pyrimidine in their DNA to 5-hydroxymethylcytosine (5hmC) and glucose-5-hydroxymethylcytosine, respectively. 5-methylpyrimidine and 5-hydroxymethyldeoxyuridine resist type II REase [12]. The iron-binding protein Mom produced by phage Mu can methyl carbamoylation its genes after binding to the cofactor acetyl CoA and Fe2+/3+, thus, it can resist various REases [110]. There is a 7-deazaguanine modifier gene cluster with a length of about 5940 bp in phage CAjan, including genesfolE,queD,queE,queC,yhhQanddpdA[111]. GTP can be converted to 7-cyano-7-deazaguanine (preQ0) under the catalysis of four enzymes (FolE, QueD, QueE and QueC) [112]. Phage CAjan inhibits the cleavage of phage DNA by restriction endonucleases with GA and GGC as recognition sites by modifying GTP to preQ0in the specific sequences GA and GGC in phage DNA. In addition, Ocr and ArdA produced by phages can also inhibit the type I R-M system. Both Ocr dimer and ArdA dimer bind to the gap between HsdRs subunits motor 1 and motor 2 in a manner that mimics DNA, inhibiting the binding of the R-M complex to phage DNA, but not its conformational transition [13]. The Ocr dimer expressed by phage T7 occupies the DNA binding site in the type I R-M system restriction enzyme EcoKI (R2M2S1) by simulating the negative surface charge of DNA (~24 bp) and the approximate 46° bending of the DNA helix axis [113,114]. The Ocr protein has also been proven to inhibit BREX defenses similar to R-M systems. The Ocr dimer expressed by phage T7 binds to the BREX system complex by simulating the shape and surface charge of DNA (~20 bp) and inhibits the BREX methylation of adenine fifth in the specific non-palindromic sequence of host DNA [115]. Furthermore, the Ocr dimer can also compete with sigma factors for nucleic acid binding channels of bacterial RNA polymerase, which inhibits sigma factors from recruiting RNA polymerase to bacterial DNA promoters, thus impeding the host transcription process [116]. ### 3.3. Anti-Defense Strategies for CRISPR-Cas Systems CRISPR-Cas adaptive immune systems are one of the most important strategies for bacteria to fight phage infection. In the face of precise attacks by bacteria, phages have also evolved a series of counterattack measures to counter the bacterial defense systems. The counterattack strategies of phages against bacterial CRISPR-Cas mainly include (i) constructing nucleus-like compartments to shield nuclease; (ii) mutating the target sequence to block the recognition of effector complexes; (iii) through Acr to inhibit the recognition or cleaving of foreign nucleic acids by effector complexes (Figure 4b). Recent studies have proven that giant phages can produce a proteinaceous nucleus-like compartment, and this protein shell can act as a physical barrier to protect phage dsDNA from nuclease hydrolysis [15]. For example, theSerratiagiant phage PCH45 without theacrgene and DNA-modifying enzyme gene can encode the nucleus-like shell to resist bacterial CRISPR-Cas systems through thegp033gene, and then successfully infectSerratiawith type I-E and I-F CRISPR-Cas [117]. However, because the phage protein translation process is located in the bacterial cytoplasm, mRNA, which is not protected by the nucleus-like compartment, can be targeted for cleavage by type III and VI CRISPR-Cas systems. Therefore, the phage-constructed nucleus-like compartment cannot resist CRISPR-Cas systems of type III and VI (the type III system can target foreign DNA transcripts, and Cas13 in the type VI system can cleave ssRNA [62]). The giant phage ΦKZ without theacrgene can also construct the nucleus-like compartment to resist bacterial types I-C, I-F, II-A and V-A CRISPR-Cas, but not type III CRISPR-Cas systems [118]. Furthermore, the nucleus-like compartment not only antagonizes the CRISPR-Cas adaptive immune systems but also impedes the R-M systems by shielding restriction enzymes [118]. Phages can block the recognition of target genes by CRISPR-Cas systems through the DNA glycosylation or mutation of PAM/protospacer. For example, the glycosylation of 5hmC in the DNA of phage T4 by glycosyltransferase can inhibit the recognition of target genes by type I-E and II-A CRISPR-Cas systems [119]. The mutation of PAM and protospacer of phage M13 enabled the phages to successfully infectE. coli[14]. However, the CRISPR-Cas systems have a certain fault tolerance rate for the mutation of the target gene, and the CRISPR-Cas systems can re-resist the phages by obtaining the new spacer [120]. The Acr evolved by phages is a widely discovered and studied anti-CRISPR-Cas strategy. At present, Acrs have been found to hinder the recognition or cleavage of foreign nucleic acids by effector complexes in CRISPR-Cas systems such as type I-C, I-F, II-A, II-C, III-A, V-A and VI-B by acting alone or in combination [16]. The identified type I-F Acrs include AcrIF1-4, AcrIF7-9, AcrIF11, AcrIF14, etc. For example, AcrIF4 blocks the formation of the active conformation of the Csy1 complex by interacting with the I-F CRISPR-Cas surveillance complex (the Csy complex) [121]; AcrIF7 mimics the bases of the target sequence and occupies the binding site of the Csy complex to DNA [122]; AcrIF9 interacts with Csy3 and induces non-specific binding of the Csy complex to DNA, which makes the Csy complex lose its specific targeting ability [123]; AcrIF11 deprived the Csy complex of dsDNA binding activity [124]. Gene35of phage JBD30, gene30of phage D3112 and gene35of phage JBD5 encode AcrIF1, AcrIF2 and AcrIF3 with anti-I-F CRISPR-Cas function, respectively [125]. Among them, AcrIF1 and AcrIF2 bind to the Csy3 and Csy1-Csy2 heterodimers of the Csy complex, respectively. AcrIF3 affects Cas3 recognition and recruitment by directly binding to Cas3 nuclease rather than binding to the Csy complex, thereby preventing Cas3 from cleaving phage DNA. Currently, the reported type II Acrs include AcrIIA1-2, AcrIIA4, AcrIIA14, AcrIIA22-23, AcrIIC1-4, etc. The mechanism of action of traditional AcrII can be divided into three categories: (i) interacting with the HNH domain of Cas9 (responsible for cleaving complementary chains) or the RuvC domain (responsible for cleaving non-complementary chains), (ii) competing with PAM recognition sites, and (iii) blocking sgRNA recruitment. The C-terminal domain of AcrIIA1 can interact with the HNH domain of Listeria Cas9 to induce the inactivation and degradation of Cas9 through a multi-step mechanism [126]. Both AcrIIA2 and AcrIIA4 can hinder the recognition of target genes by occupying the PAM recognition site of Cas9 [127,128]. In addition, AcrIIA4 can also interact with the RuvC domain of Cas9 to block Cas9 from cleaving target genes [129]. The C-terminal domain of AcrIIA14 binds to the HNH domain of Cas9, which can inhibit the cleavage activity of Cas9 [130]. Similarly, AcrIIC1 can also directly bind to Cas9 and inhibit the cleavage activity of Cas9 [131]. The highly negatively charged AcrIIC2 can bind to the positively charged bridge helix of Cas9. AcrIIC2 prevents gRNA from forming complexes with Cas9 by occupying the gRNA binding site on Cas9 [132]. The two AcrIIC3 links the HNH domain of Cas9 and the other REC2 domain of Cas9, causing Cas9 dimerization and hindering the formation of the active conformation of the HNH domain, thus inhibiting the binding and cleavage of Cas9 to the target gene [133,134]. In addition, AcrIII, AcrV and AcrVI have been gradually discovered. AcrIII-1 with ring nuclease activity degrades cyclic tetra-adenylate (cA4) into A2>P and A2-P in the form of a dimer, thereby inhibiting the activation of RNase by cA4[135]. Negatively charged AcrVA1 can occupy the PAM binding site of Cas12. Moreover, after AcrVA1 binds to Cas12, crRNA can be cleaved into two parts by Cas12. Additionally, AcrVA4 dimer can block the formation of the active conformation of Cas12a [136]. Similarly, after binding to Cas13a, AcrVIA1 inhibits the formation of active conformations of Cas13a that can bind to target RNA [137]. AcrVIA2 or AcrVIA3 can bind to the Cas13a-crRNA complex instead of Cas13a, hindering the cleavage of the target RNA [138]. In addition, Chevallereau A, et al. demonstrated that when Acr-positive and Acr-negative phages co-infected bacteria, the presence of Acr-positive phages facilitated the maturation of Acr-negative phage replication in the host cell [139]. With the deepening of the research on phages Acr, more and more new Acr are being discovered. This helps people to enrich their understanding of phage’s anti-bacterial mechanisms. Besides, the anti-CRISPR-associated (aca) gene, which is found near theacrgene, encodes the protein Aca, which contains a helix-turn helix domain. The Aca2 homodimer ofPectobacterium carotovorumphage ZF40 binds to theacrpromoter and can inhibit the transcription ofacr[140]. Theaca1gene located downstream of theacrIF1gene inP. aeruginosaphage JBD30 can express the Aca1 protein. Aca1 binds to theacrIF1promoter in the form of the homologous dimer to inhibit the transcription of theacrIF1gene [141]. ### 3.4. Anti-Defense Strategies for QS System For the QS system of bacteria, phages’ counterattack strategies include: (i) expressing anti-repressor and binding cI repressor to make phages enter the lysis cycle (Figure 7a); (ii) synthesizing receptors that can bind to AIs or synthesizing AIs-like proteins to prevent AIs from binding to their corresponding QS receptor. [ijms-24-04363-f007] Temperate phages are essential in the evolution and diversity of microbial populations [142]. Temperate phages do not lysis host cells and produce progeny phages during the lysogenic cycle, but make their genes integrate with host bacteria chromosomes and pass along with the division of bacteria. When the phages enter the lysis cycle from the lysogenic state, they can produce mature progeny phages, which mediate the lysis death of bacteria. The switch between the phage’s lysogenic cycle and lysis cycle is the cI repressor in host cells. By binding with the Q promoter, the cI inhibitor inhibits the expression of the phage’s lysing gene, leaving the phages in the lysogenic state, so that no progeny phages can be produced [143]. However, the antirepressor can inhibit cI activity, causing the phages to enter the lysis cycle and promote host cell lysis. The repressor was first identified in phage P22 and was named Ant [17]. A repressor named Qtip was found in phage VP882 [144]. Under the condition of high cell density, Qtip composed of 79 amino acids can recognize and bind the DNA-binding domain of the N-terminal of cI, inhibiting the activity of cI [145,146] (Figure 7b). It is a common strategy for phages to resist the QS system to prevent AIs from binding to their receptors by producing receptors that can bind to AIs or by synthesizing proteins similar to AIs. For example, the genep37that encodes the LuxR-type transcription factor was found in phage ΦARM81ld [18]. LuxR encoded byp37can bind to C4-HSL as AIs, which hinders the binding of C4-HSL and LuxR in the bacterial QS system. Phage VP882 encodes the VqmA QS receptor (VqmAPhage), a homology of Vibrio cholerae VqmA (VqmAVc) [143]. VqmAPhagecan bind to 3,5-dimethylpyrazin-2-ol (DPO), which hinders the binding of VqmAVcand DPO (Figure 7c). Furthermore, the binding of VqmAPhageto DPO can activate the expression of the anti-inhibitory factor Gp55. Gp55 can directly act on the cI repressor to inactivate cI, thus causing phages to enter the lysis cycle. Phage DMS3 encodes Aqs1 protein that can bind to LasR, hindering the binding ofP. aeruginosaAIs to its receptor LasR [147]. Aqs1, which consists of 69 residues, binds as a dimer to the N-terminal DNA-binding domain of LasR, hindering AHL binding to lasR in the lasR/lasI-type QS system. Aqs1 also inhibits the production of another class of AIs, the quinolone system (PQS), by down-regulating the pqsABCDE and phnAB operons [148] (Figure 7d). The quorum-sensing targeting protein encoded by phage LUZ19 can also inhibit PQS production by interacting with PQS biosynthetic pathway enzymes [149]. ## 4. Conclusions The mutual defense strategies between bacteria and phages are gradually being clarified. This review details bacterial anti-phage strategies and phages anti-defense measures to deeply understand the interaction mechanism between bacteria and phages, which is significance for the development and application of modern biotechnology. At present, the defensive and anti-defensive measures between bacteria and phages have been able to solve many practical problems. For example, CRISPR-Cas technology can be used for pathogen nucleic acid detection [150], CRISPR-Cas gene editing technology for designing new strains with enhanced beneficial functions [151], the depolymerase produced by phages can be used as a new anti-biofilm agent [152], the problem of phage contamination during fermentation can be solved based on the interaction between phages and bacteria [153] and phage therapy can be used to treat bacteria, especially to treat infections with drug-resistant bacteria [154]. The emergence of superbugs poses a serious threat to human health, making the problem of drug resistance to bacteria the focus of global attention. Resistant genes can be transferred between bacteria to create new resistant combinations [155]. As a new type of therapy, phage therapy has been used in practical clinical treatment [156]. Phage therapy is expected to be used in combination with antibiotics to address the problem of bacterial resistance. One of the problems facing phage therapy is that bacteria evolve their resistance to phages [157]. The biofilm that forms whenP. aeruginosainfects the lungs of people with cystic fibrosis can block antibiotics from entering bacterial cells [158]. At the same time, as a natural barrier, biofilm facilitates bacteria to stay on the surface of living and non-living organisms [159]. This can easily lead to nosocomial infections. Giant phages are often used to treat CF patients infected withP. aeruginosa. Phages can not only lysis bacteria but also reduce biofilms through polysaccharide depolymerase. However, the emergence of phage-resistant mutant strains prevents phage therapy from treating resistant bacteria. Understanding the evolution direction of phage-resistant mutant strains is important for the treatment of drug-resistant bacteria relying on cocktail therapy or the combination of phage therapy and antibiotics. Phage cocktail therapy, which consists of different phages, is more beneficial for the treatment of drug-resistant bacterial infections [160]. In conclusion, some of the defensive or anti-defensive systems found in the current research may be effective tools for solving practical problems in the future. Among the defense and anti-defense measures between bacteria and phages, R-M, CRISPR-Cas, Abi and QS systems have been studied more deeply, while the anti-defense measures taken by phages against bacterial mutant receptors have been less studied. Besides, there are many new defensive and anti-defensive measures whose specific mechanisms of action have not been elucidated and need to be further studied. The arms race between bacteria and phages is conducive to rapid coevolution between them. Meanwhile, temperate phages can also promote the adaptive evolution of the host [161]. Phages and their hosts can exchange genes through horizontal gene transfer, driving coevolution [162]. The coevolution of bacteria and phages can increase the mutation rate of bacteria. The mutant bacterial population can play a greater advantage in the arms race with phages [163]. At the same time, coevolution can also improve the rate of phage’s evolution [164]. However, the role of the community environment in the interaction between bacteria and phages is not fully understood, and many problems still need to be further explored [165]. ## Acknowledgments We apologize to the researchers not cited in the manuscript due to limited space. ## Author Contributions Conception and design: Y.W. Writing—original draft: all authors. Writing—review and editing: all authors. Revision for intellectual content: all authors. Final approval of the version to be published: all authors. All authors agree to be accountable for all aspects of the work. All the authors meet the criteria for authorship as per the ICMJE criteria. All authors have read and agreed to the published version of the manuscript. ## Institutional Review Board Statement Not applicable. ## Informed Consent Statement Not applicable. ## Data Availability Statement Not applicable. ## Conflicts of Interest The authors declare no conflict of interest. ## Funding Statement This research was supported by National Key Research and Development Program of China (NO. 2018YFA0903000, 2020YFC2005405, 2020YFA0712100, 2020YFC0840805), Funds for First-class Discipline Construction (NO. XK1805, NO. XK1803-06), Inner Mongolia Key Research and Development Program (NO. 2019ZD006), NSFC-MFST project (China-Mongolia) (NO. 31961143024), Fundamental Research Funds for Central Universities (NO. BUCTRC201917, BUCTZY2022), Innovation & Transfer Fund of Peking University Third Hospital (BYSYZHKC2022114). ## Footnotes ## References ## Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. ### Data Availability Statement Not applicable.	[ "Yuer Wang", "Huahao Fan", "Yigang Tong" ]	International Journal of Molecular Sciences	10.3390/ijms24054363	36901793	7	7	1,562	50,162
PMC10002487	Why Don’t the Mutant Cells That Evade DNA Repair Cause Cancer More Frequently? Importance of the Innate Immune System in the Tumor Microenvironment	The standard of care for most malignant solid tumors still involves tumor resection followed by chemo- and radiation therapy, hoping to eliminate the residual tumor cells. This strategy has been successful in extending the life of many cancer patients. Still, for primary glioblastoma (GBM), it has not controlled recurrence or increased the life expectancies of patients. Amid such disappointment, attempts to design therapies using the cells in the tumor microenvironment (TME) have gained ground. Such “immunotherapies” have so far overwhelmingly used genetic modifications of Tc cells (Car-T cell therapy) or blocking of proteins (PD-1 or PD-L1) that inhibit Tc-cell-mediated cancer cell elimination. Despite such advances, GBM has remained a “Kiss of Death” for most patients. Although the use of innate immune cells, such as the microglia, macrophages, and natural killer (NK) cells, has been considered in designing therapies for cancers, such attempts have not reached the clinic yet. We have reported a series of preclinical studies highlighting strategies to “re-educate” GBM-associated microglia and macrophages (TAMs) so that they assume a tumoricidal status. Such cells then secrete chemokines to recruit activated, GBM-eliminating NK cells and cause the rescue of 50–60% GBM mice in a syngeneic model of GBM. This review discusses a more fundamental question that most biochemists harbor: “since we are generating mutant cells in our body all the time, why don’t we get cancer more often?” The review visits publications addressing this question and discusses some published strategies for re-educating the TAMs to take on the “sentry” role they initially maintained in the absence of cancer. Keywords:glioblastoma, tumor microenvironment, macrophages, repolarization, chemokines, immunotherapy	## 1. Introduction Glioblastoma (GBM) is one of the deadliest forms of cancer, with an average life expectancy of about 14–18 months from detection [1]. The standard of care (SOC) for GBM is surgical resection of the tumor followed by chemo and or radiation therapy to eliminate the residual cancer cells [2,3]. However, in most cases, GBM returns soon after the SOC and eventually overcomes the patient. In chemotherapy, the general strategy has been the use of antimetabolites that inhibit DNA replication and other compounds that target specific signaling proteins that are often overactivated by mutations [4]. Unfortunately, such chemotherapeutic agents also inhibit the normal signaling proteins needed by healthy cells, such as the immune cells, thus causing severe side effects linked to lymphopenia. On the other hand, though targeted to cancer cells, radiation therapy kills the juxtaposed normal cells, such as the microglia, macrophages, and the infiltrating immune cells, thereby weakening the overall system. Overall, such therapeutic strategies have not significantly extended the life of GBM patients. Despite the ongoing effort to develop effective therapeutic strategies, an important question remains: “biochemical knowledge reveals that, despite effective DNA repair, we are constantly generating some cells with mutant DNA molecules, so why don’t we, relatively speaking, develop cancer more frequently?” A general belief is that our vigilant immune cells promptly eliminate such mutant cells. However, when our immune system is weakened, the mutant cells can proliferate to precipitate cancer, especially in the later years. We found hard evidence corroborating this belief in a study conducted by Afshar-Sterle and coworkers, which showed that the loss of the tumor-suppressor function of the geneBLIMP1or deregulated expression of theBCL6oncogene occurs in a large portion of B-cell lymphomas in human patients, however, the deliberate introduction of Blimp1 deficiency or Bcl6 overexpression in the B cells of mice does not precipitate lymphoma unless the T-cell receptor CD28- and Fas-ligand activities are simultaneously impaired in the CD8+ Tc cells [5]. Additionally, consistent with the hypothesis that cells with mutated DNA are eliminated by microglia and macrophages, Shi and coworkers observed that consequent toKnl1deletion, neural progenitor cells accumulate DNA damage on mis-segregated chromosomes in the mitotic spindle, which triggers apoptosis and phagocytosis by the microglia [6]. However, Kasapi and Triantafyllopoulou note that the “role of genotoxic stress as an instructor of macrophage-mediated immune defense and tissue remodeling is only beginning to be understood” [7]. Therefore, more research is required to elevate the currently-held belief to a widely-accepted phenomenon. ## 2. The Dichotomous Role of Tumor-Associated Microglia and Macrophages and Possible Triggers to Turn Them against the GBM Tumor During the last decade, a significant focus has been placed on the adaptive immune system as a tool to eliminate cancer cells. This has resulted in the development of cytotoxic T-cell (Tc)-based immunotherapy [8], which has shown considerable success in several cases of melanoma [9,10], but, unfortunately, not for GBM and some peripheral cancers, such as endometrial/ovarian, pancreatic, liver, and colon cancers, to name a few. Furthermore, adverse events, mainly due to autoimmune reactions, have been reported following Tc-based immunotherapy [11]. As for the immediately-acting innate immune cells such as microglia and macrophages, they are recruited into the GBM tumor and changed from the tumoricidal, “classically-activated” “M1”-type to a tumor-promoting, “alternatively-activated” “M2” phenotype by cytokines secreted by the GBM cells [12]. Thus, the GBM microenvironment harbors mostly M2-type tumor-associated microglia/macrophages (TAMs), very few M1-type microglia, and some nonactivated M0-type microglia [12]. Since the direct killing of GBM cells has proven to be ineffective in eliminating all tumor cells and reliably preventing cancer relapse, an attractive strategy could be to re-educate the M2-type microglia or macrophages in the tumor microenvironment (TME) to the M1-type, thereby launching a Trojan horse-like attack from inside the tumor. A few such strategies have been discussed here. ## 3. Tools to Topple the STAT-3/STAT-1 Balance in the Microglia and Macrophages and Kill the GBM and GBM Stem Cells The M2 state of the microglia and macrophages is centrally controlled by the transcription factor STAT-3, which is known to stimulate the expression of immune-suppressive cytokines like IL-10, IL-4, and IL-13 [13]. In addition, it upregulates the expression of the key enzyme Arginase-1 (Arg-1) that marks the M2-type microglia and macrophages [12,13,14]. The cytokine IL-10 causes inhibition of STAT-1 by suppressing the phosphorylation of this transcription factor [12,14]. Therefore, the inhibition of STAT-3 would cause an activation of STAT-1 and subsequent STAT-1-mediated events such as the induction of inducible nitric oxide synthetase (iNOS; also known as NOS2), MCP-1, and IL-12, which is typical of M1-type microglia and macrophages [12,14,15,16]. Furthermore, we know from earlier studies that upon release from the microglial cells in the brain, the chemokine MCP-1 (a.k.a. CCL2) crosses the blood-brain barrier into the peripheral system to bind to its receptor, CCR2, expressed by activated macrophages and natural killer (NK) cells, and thereby cause recruitment of these cells into the GBM tumor in the brain [15,16,17]. Thus, the inhibition of STAT-3 in the microglia is central to a process that links to the recruitment of an army of M1 macrophages and activated NK cells into the GBM to eliminate GBM cells and GBM stem cells [15,16,18,19,20]. Due to the mechanisms discussed in the previous section, finding or designing agents to inhibit STAT-3 has been a popular strategy among researchers keen on developing therapies against cancer [21]. Yet no FDA-approved STAT-3 inhibitor is available currently. Several natural products (mostly polyphenols and antioxidants) that inhibit STAT-3 have been used in preclinical studies against various types of cancer [22]. We have shown in a series of publications that curcumin (CC) and synergistic formulations of CC and other polyphenols, such as resveratrol (Res) and epicatechin gallate (ECG) (TriCurin), can inhibit STAT-3 in the microglia and macrophages in GBM as well as HPV+ cervical cancer, thereby repolarizing these cells in the TME to the M1 phenotype [15,19,20,23]. Almost all chemotherapeutic agents (CAs) are designed to block DNA replication in fast-dividing cells such as cancer cells. Intriguingly, at least one, paclitaxel (Taxol), functions by blocking the microtubule-dependent cell division machinery. Additionally, this same chemotherapeutic agent (Taxol) is known to inhibit cytokine-mediated STAT-3 activation and its interactions with microtubules [24]. Therefore, the efficacy of Taxol in eliminating tumor cells through the repolarizing of the TAMs from the M2 to M1 type deserves further investigation. ## 4. Debate over Arginase-1 Expression by Tumor-Associated Microglia/Macrophages in Humans versus Mice As mentioned in the previous section, Arg-1 is highly expressed by M2-type microglia and macrophages. This urea cycle enzyme is believed to deplete the amino acid arginine, which is also a substrate for the enzyme iNOS that is highly expressed by the M1-type microglia and macrophages [12,15,19,23]. iNOS uses arginine as its substrate to generate nitric oxide (NO), a crucial signaling molecule that combines with reactive oxygen species to generate cytotoxic, reactive nitrogen species inside the tumor [25], thereby eliminating cancer cells and cancer stem cells. A high Arg-1 expression in the M2 microglia and macrophages is expected to disrupt the supply of arginine to iNOS, thus inhibiting the generation of NO and reactive nitrogen species. Therefore, Arg-1 expression by TAMs is a critical event determining their polarization states. Yet, currently, there is considerable debate over using Arg-1 to mark the activation state of human microglia and macrophages [26,27]. It seems that although mouse monocytes show IL-4-evoked induction of Arg-1, this is not observed in human monocytes [26,28]. The literature on the induction of Arg-1 by interleukins is replete with many mechanisms, and Makita and coworkers report that human IL-10 augments IL-4-mediated induction of Arg-1 in monocytes [29]. Furthermore, Kupani and coworkers observed IL-10- and TGFβ-induced expression of Arg-1 in human monocytes [30]. To address this dichotomy, Thomas and Mattila state that cultured monocytes from various sources can elicit responses that are different from macrophage responses in vivo [27]. Their second but legitimate argument is that these debating groups had attempted to identify the Arg-1 protein instead of measuring its activity. However, most biochemists will agree that the apparent absence of a protein is not a full-proof sign of non-expression of the enzyme mainly due to the differing sensitivities of the antibodies and the high Vmaxvalue of Arg-1, which, therefore, can produce ornithine at very low concentrations. Cognizant of this controversy, all of our studies of M2 → M1 repolarization of TAMs have used in vivo analysis using either immunohistochemistry (IHC) or flow cytometry analysis of dissociated tumor cells after fixing and antibody staining [15,16,19,20,23]. Thus, it is likely that data from mice and humans would be similar if the experiments were conducted on intact tumor tissue rather than cultured monocytes. ## 5. Recruitment of Activated Natural Killer (NK) Cells into the GBM Tumor Among the innate immune cells, interferon gamma (IFNγ)-activated NK cells are known to play a crucial role in eliminating cancer cells and cancer stem cells [16,20]. The mechanisms of NK cell-mediated elimination of microglia and macrophages have been studied earlier. Thus, Lunemann and coworkers used human microglia and human NK cells to show that IL-2-activated NK cells formed immune-synapses with resting (M0) microglia to kill them but sparing the lipopolysaccharide (LPS)-activated microglia (M1) [31]. This microglia recognition occurred mainly through the NK-cell-harbored receptor proteins NKG2D and NKp46 since the antibodies to these proteins blocked the killing completely. Furthermore, MHC class I molecules modestly expressed by the microglia appeared to abrogate NK-cell-mediated killing due to toll-like receptor 4 (TLR4) stimulation by LPS, thus protecting these microglial cells. Intriguingly, in vitro cultured peripheral blood monocyte-derived macrophages were not protected from the NK cells following LPS activation. Based on the ability of NK cells to eliminate tumor cells, they have been considered for use in clinical trials involving immunotherapy [32,33,34,35,36]. Although it is accepted that NK cells are recruited into the GBM tumor, how they are drawn into the brain has been an important question, with multiple chemokines proposed to be involved by various research teams. A study showing NK cell chemotaxis into the liver during infection noted the involvement of the chemokine MIP-1a (a.k.a. CCL3) [37]. Morrison and coworkers observed that CCL2 was involved in NK-cell recruitment into the lungs during aspergillosis [38], and Hokerness and coworkers showed that this NK-cell recruitment required CCL2 plus its receptor, CCR2 [39]. Additionally, Trifilo and coworkers report that CXCL10 promotes innate defense against coronavirus infection by recruiting and stimulating NK cells [40]. In our studies in the GBM mouse model, we have observed that repolarization of the TAMs from M2 to the M1 state is associated with a dramatic increase in the expression of CCL2 (a.k.a MCP-1) in the microglia/macrophages, which is concomitant with the recruitment of activated NK cells into the TME [15]. Earlier research has demonstrated that CCL2 is expressed as a marker by M1 microglia and macrophages [41,42]. Furthermore, CCL2 reportedly can compromise the blood–brain barrier (BBB) and translocate from the brain to the peripheral system, thereby affecting recruitment of immune cells such as M1-type macrophages and NK cells, which express the CCL2 receptor CCR2 [43,44,45,46]. Based on these findings, we have proposed that after the initial repolarization of the microglia in the GBM TME from M2 → M1 in a syngeneic mouse model after curcumin treatment, CCL2 released by the TAMs causes intratumor recruitment of activated M1-type macrophages and IL-12-activated NK cells from the periphery [15]. Once inside a tumor, the role of activated NK cells in eliminating tumor cells has been more generally accepted. As mentioned earlier, NK cell-based immunotherapy has been considered for clinical trials [32,33,34,35,36]. In the clinical application of NK cell therapy, deliberate intratumor infusion of NK cells is followed by IL-2 administration to activate the introduced NK cells. However, several factors render in vivo IL-2-mediated activation of NK cells a risky strategy. In addition to toxicity due to IL-2 administration, this causes the proliferation of immunosuppressive regulator T (Treg) cells [47]. Therefore, NK cell therapy has relied on in vitro IL-2 activation of NK cells followed by infusion of the activated cells. In our syngeneic mouse models of GBM and human papillomavirus (HPV)-mediated cancer, we have consistently observed the recruitment of activated NKp46+ NK cells and Tc cells into a tumor in mice treated with curcumin or a synergistic formulation containing curcumin, resveratrol, and epicatechin gallate, Tricurin (Figure 1) [15,19,20]. During our studies in the GBM mice, we also discovered an additional property of NK cells. NK cell recruitment was responsible partly for the curcumin-triggered repolarization of the TAMs from M2- to M1-type [15]. The intriguing offshoot of our studies is that both curcumin and Tricurin appear to be safe tools that can replace IL-2 in causing the activation and intratumor recruitment of NK cells [15,19]. Taken together, safe strategies appear to be available to turn both the TAMs and the NK cells against tumor cells that may have acquired diverse mutations in the process of becoming malignant. [ijms-24-05026-f001] ## 6. Multiple Strategies of Immunotherapy and the Involvement of the Innate Immune System Currently, immunotherapy, popularly known as “immune checkpoint inhibitor therapy,” mainly refers to a strategy of empowering CD8+, cytotoxic Tc cells of the adaptive immune system to eliminate cancer cells [48]. In order to prevent autoimmune attacks, the antigen-presenting cells of an organism express program cell death ligands (PD-L1), PD-L2, as well as the major histocompatibility complex (MHC), which bind to the protein program cell death one (PD-1) and the TCR/CD3 complex, respectively, thereby dampening the cytotoxicity of the Tc cells [48]. Most cancer cells also express high levels of PD-L1 to evade attack by Tc cells. Currently, two FDA-approved PD-1 antibody-based immunotherapy drugs are marketed under the names, Keytruda and Opdivo [49,50]. Additionally, the Tc cells express a protein, receptor protein cytotoxic T lymphocyte antigen four (CTLA4), which binds to ligands CD80 and CD86 expressed by antigen-presenting cells and cancer cells [8]. This CTLA4–CD80/CD86 interaction antagonizes the interaction of the Tc antigen CD28 with CD80/CD86, which activates the Tc cells. Therefore, CTLA4 inhibition would cause the activation of Tc cells against cancer cells. To achieve this, the FDA-approved, antibody-based drug Yervoy has been used for various types of cancer, including melanoma [51]. Another potential candidate protein to be included in immunotherapy is COP9 signalosome 5 (CSN5). Lim and coworkers have shown that CSN5, which is induced by nuclear factor kappa B (NF-κB) p50:p65 heterodimer (NF-κB p65), is required for tumor necrosis factor alpha (TNFα)-mediated stabilization of PD-L1 in cancer cells [52]. In their study, curcumin-evoked inhibition of CSN5 caused a decrease in PD-L1 expression in cancer cells, sensitizing them to anti-CTLA4 therapy. Intriguingly, curcumin also inhibits CTLA-4 [53]. Therefore, the inclusion of CSN5 as a target could increase the efficacy of immunotherapy. Finally, a newly invented strategy involving “Base Editing” appears to have given some leukemia patients a new lease on life [54]. Developed six years ago by David Liu, this technique of base editing uses a mutated version of the CRISPR Cas9 protein to target DNA sequences containing a “C” or an “A” to convert them through deamination to U and inosine (I), respectively. Coupling this step with inhibitors of the base excision repair enzymes enabled Liu and coworkers to produce mutations that can correct or introduce pathogenic changes [55]. Using this strategy and allogenic Tc cells, mutant Tc cells were created that could eliminate malignant and normal Tc cells of a leukemia patient, thus making the patient cancer-free [54]. Typically, this step is followed by a transfer of healthy bone marrow-derived T cells to the patient. As for immunotherapy for glioblastoma in particular, most attempts have yielded only limited success [56]. Nevertheless, experimental evidence has suggested that manipulating the innate immune system might be beneficial. The discussion above shows that immunotherapy has so far involved the adaptive immune system. Two questions remain: (one) does the innate immune system influence the adaptive immune system, and does manipulating the adaptive immune system enhance the immunotherapy in use so far? and (two) has the innate immune system been considered as a primary mode of attack on cancer cells? Answers to the first question come from studies on dendritic cells (DCs), which, as innate immune cells, are known to be involved in the recruitment and activation of the Tc cells. Unlike the macrophages, which are recruited into the brain, likely by chemokines, the DCs, though not present in the brain parenchyma, are concentrated in the blood vessel-rich regions around the ventricles, such as choroid plexus and meninges [57,58,59]. From these niches, the DCs migrate to the brain and spinal cord under pathological conditions via lymphatic ducts or blood capillaries [60]. Among the different types of DC cells, the plasmacytoid DCs (pDCs) recognize pathogens such as viruses through toll-like receptor TLR7- and TLR9-signaling and secrete type 1 interferons (IFN1), which strongly activate CD8+ Tc cells [61,62,63]. Intriguingly, similar to the M1-type microglia and macrophages, the DCs respond to inflammation and infection by secreting inflammatory cytokines like IL-6 and IL-12 and chemokines CCL3, CCL4, CXCL8, and CXCL10 to recruit immune cells [64]. Similar to the DCs, the microglia are also known to cause recruitment of T cells from the periphery, although through a mechanism that involves the noncanonical nuclear factor κB (NF-κB)-inducing kinase (NIK) [65]. Additionally, other researchers have reported reciprocal signaling between the CNS microglia and the effector Tc cells in the context of neurodegenerative diseases and glioblastoma [66,67], and general surveillance of the CNS [68]. Thus, antigen-presenting cells such as DCs and microglia can regulate the recruitment and activation of Tc cells. The innate immune cells, like engineered DCs and activated NK cells, have been used in glioblastoma therapy [33,34,36,69]. It appears from the observations of repolarization of the microglia and the macrophages, intratumor recruitment of NK cells, and inhibition of CSN5 [15,16,19,20,23,52], that involvement of the innate immune system to assist the adaptive immune system may yield an effective and safe strategy of eliminating GBM as well as other solid tumors. Finally, question (two) has been answered in therapeutic applications of dendritic cells and NK cells, as discussed before [33,34,36,69]. Due to our particular interest in GBM therapy using microglia and macrophages, we next focused our attention on the use of these antigen-presenting innate immune cells. Reports of using macrophages in cancer therapy appear to be undergoing explosive growth. These studies can be classified roughly into two groups: (one) elimination of tumor-promoting TAMs (M2-type) and the inhibition of further recruitment into the tumor, and (two) reprogramming of the M2 TAMs into the tumoricidal M1 TAMs. However, the more effective antitumor treatments appear to involve a combination of traditional chemotherapy with the targeting of TAM, followed by the emerging immunotherapy involving immune checkpoint inhibition by targeting PD-1, PD-L1, or CTLA4, as discussed earlier. Inhibition of macrophage recruitment into tumors to inhibit M2-type macrophage-evoked tumor progression and metastasis was attempted by blocking some chemokine signaling pathways that cause the intratumor recruitment of macrophages. Such chemokine signaling involved the receptors for CCL2 (CCR2), CCL5 (CCR5), and CXCL12 (CXCR4) [70], which also enhanced STAT-3 activity and M2 polarization of macrophages and retention inside the tumor [71,72]. Fourteen clinical trials targeting the CCL2/CCR2 axis using five investigational drugs have been conducted with disappointing results. One of these drugs (BMS813160) is currently in Phase II trials for colorectal and pancreatic cancer [73,74,75]. The disappointing outcome was attributed to improper patient selection. It was felt that patients selected for high CCR2 expression in their tumors would have shown a more robust response in the clinical trials. Selective inhibition of a single, specific target with drugs has been attempted in most clinical studies, however, they have yielded inconsistent results and precipitated many side effects. For example, the CCL2 pathway is also crucial for the normal functioning of the lungs and the digestive system; therefore, such attempts to shut down specific signaling pathways could be detrimental to the patient [73,76]. Similar inhibition of the CCL5/CCR5 pathway has been studied as a possible target for eliminating TAMs, and the FDA-approved HIV drug Maraviroc is currently being considered for cancer [77,78]. Among the other attempts to deplete TAM, targeting the colony-stimulating factor (CSF-1)/CSF-1R pathway, which is known to trigger TAM recruitment into tumors and polarization of these cells into the M2-like phenotype, has been considered. Some preclinical models showed that CSF-1R inhibition causes reduced TAMs and tumor growth [79]. However, other reports indicated that inhibition of the CSF-1/CSF-1R axis did not obliterate all macrophages but pushed the TAMs toward the M1-like phenotype triggering CD8+T cell activation and inhibiting tumor progression [80,81]. Furthermore, CSF-1R blockade only caused a modest delay in tumor growth, thus yielding only limited therapeutic success [80,81]. An FDA-approved, small-molecule CSF-1R kinase inhibitor, BLZ945, did not eliminate macrophages in lung cancer but reprogrammed them into the M1 phenotype and triggered the recruitment of IFNγ-wielding NK and Tc cells and also IL-12-secreting dendritic cells with antitumor activity [82]. The macrophage repolarization strategy has also been tested by using agonists for the toll-like receptors TLR3, TLR4, and TLR7/8, which are known to repolarize M2-like TAMs into M1-like phenotypes to levels comparable to that achieved with lipopolysaccharides and IFNγ [83]. Another preclinical study was conducted using poly-ICLC (polyinosinic-polycytidylic acid), a TLR3 agonist, with promising results [84]. A relatively new strategy of repolarizing TAMs involves the cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS)-stimulated interferon gene (STING) pathway, which appears to be sensitive to cytosolic DNA, typically observed in tumor cells. This cGAS-STING signaling pathway launches innate immune responses, producing type I interferons, which trigger M1 polarization of TAMs and subsequent adaptive immune response [85,86,87]. A STING agonist, 5,6-dimethyl xanthenone-4-acetic acid (DMXAA) (a.k.a. Vadimezan), was used in clinical trials [88,89], however, the phase III clinical trial failed to show any positive outcome. Possible reasons were proposed for this failure, pointing to the species-specificity of the DMXAA, which may not activate human STING, and that DMXAA targets only highly vascularized cancers. In contrast, the ones included in the Phase III trial had normal vasculature. Furthermore, DMXAA may cause hypoxia after vasculature reduction, which would induce the production of the vascular endothelial growth factor (VEGF) and angiogenesis. Thus, DMXAA treatment and an angiogenesis inhibitor could prove more effective against cancers. It should be noted that almost all of the studies involving the strategies of repolarizing the TAMs were combined with other treatments, such as checkpoint-inhibition immunotherapy, chemotherapy, or radiotherapy. Since the M1-polarized microglia and macrophages are known to cause recruitment and activation of NK cells and Tc cells, which have antitumor effects, most future studies will test “multi-therapy” rather than monotherapy. One more valuable message can be derived from the failed clinical trials: most therapeutics against diseases follow the general concept of targeting one signaling molecule since in vitro studies in test tubes and cultured cells are used to confirm the specificity of the targeting agent against that signaling molecule. In this process, a novel targeting molecule is synthesized and patented. However, after the FDA eventually approves this molecule to target a specific protein and treat a specific symptom, the same molecule is often found to also function on another target, allowing it to be repurposed for an unrelated condition. As a good example, the diabetes medication Metformin has been repurposed to treat Fragile X-syndrome-linked symptoms [90]. Most beneficial compounds found in nature and in our diet are similarly pleiotropic, functioning on multiple targets (Figure 1). The major difference between the dietary compounds and the synthetic compounds is centered around the fact that none of the beneficial dietary compounds shut down one specific biochemical pathway completely. In sharp contrast, many synthetic compounds do so, which often causes injury to normal, noncancerous cells, thereby precipitating significant adverse effects. Although many such beneficial natural compounds are currently being studied in preclinical studies, they are rarely considered for clinical trials. In a double-blinded placebo-controlled Phase I clinical trial of 25 subjects, including an arm of biopsy-proven head and neck cancer patients, the subjects received a synergistic drug combination (APG-157) derived from the dietary spice turmeric [91]. The drug was delivered in a pastille form that enabled topical absorption into the tumors in the oral cavity and into the oropharyngeal tumor through salivary transport and systemic absorption through sublingual and buccal absorption. Thus, the drug was rapidly absorbed directly into the tumor and showed rapid systemic absorption [92]. This study used circulating plasma cell-free RNA (cf-RNA) as an effective indicator of drug response on tumor breakdown [90]. The promising observation made by this group included the upregulation of RNA transcripts bearing signatures of an inflammatory response, leukocyte activation, and upregulation of inflammatory cytokines in APG-157-treated patients but not in the healthy or placebo-treated patients. These changes indicate an immune response and a mobilization of immune cells triggered by the treatment. An especially striking observation was the increase in TNF-α response which points to an increase in tumor apoptosis. Since inflammatory cytokines secreted by immune cells in the TME play a vital role in TAMs’ repolarization into the M1 phenotype, the increase in TNF-α transcripts in cf-RNA observed in this case reflected M2 → M1 repolarization of TAMs in the TME (Figure 2). M1 macrophages release proinflammatory cytokines, such as TNF-α, along with IL-1β, and IL-6, to activate innate immunity and kill tumor cells [93]. The pleiotropic action of the drug was further confirmed by (i) the ability of the drug to reverse the cancer-driven dysbiosis of the oral microbiome, as measured by 16S RNA sequencing, and (ii) immunofluorescence of the tumor tissues before and after the drug administration showing immune system activation by recruitment of CD8+ Tc cells to the tumor as expected when TME experiences M2 to M1 reprogramming of TAM. [ijms-24-05026-f002] The cells and signaling activities of the innate immune system have been discussed in the preceding paragraphs. Still, it is equally important to understand that innate immunity also arises within aberrant cells, which are different from the innate immune cells, causing their self-elimination through apoptosis [94]. It is quite likely that such innate immunity within aberrant cells is one of the reasons why a defect in the nucleic acid sequence or structure rarely leads to cancer. Viewed from a different angle, continuous inflammatory signals released by such aberrant cells may also create a condition conducive to carcinogenesis [95]. Named as “R-loops”, cells acquire nucleic acid structures comprising an RNA–DNA hybrid and a non-template, single-stranded DNA. The R-loops have been implicated in human diseases, including repeat-expansion disorders, neurological syndromes, and cancer [96,97]. In cancer cells with mutations in, for example, the breast cancer predisposition geneBRCA1, which is known to code for a protein involved in DNA repair [94,98], a significant portion of the RNA–DNA hybrids exit the nucleus and accumulate in the cytoplasm. This gives rise to “innate immunity”, which can also occur in the presence of cytoplasmic DNA from pathogens. The signaling that results from such cytoplasmic DNA or RNA–DNA hybrids involves two major types of proteins, cGAS and the toll-like receptors TLR-3 and TLR-9, which selectively bind to cytoplasmic DNA hybrids and trigger downstream signals [99,100,101]. Although both cGAS and TLRs are expressed mainly by the innate immune cells, they are also expressed by the tumor cells. Using the classic cervical cancer cell line HeLa in culture, Crossley and coworkers achieved induction of cytoplasmic RNA–DNA accumulation by knocking down the RNA–DNA helicase (SETX) or the breast cancer geneBRCA1. Thus, they demonstrated that induction of cytoplasmic RNA–DNA hybrids sets off an innate immune response even in cancer cells, thereby triggering Ser386 phosphorylation of the interferon regulatory transcription factor 3 (IRF3), which in turn induces apoptosis [94]. The induction of cytoplasmic RNA–DNA hybrid levels also caused a dramatic increase in the signaling proteins interferon β (IFNβ), interferon-stimulated gene 15 (ISG15),ISG20, chemokine ligand 5 (CCL5), and tumor necrosis factor (TNF). In the presence of the cGAS inhibitor RU.521 or after depletion of TLR3, a sharp decrease in phosphorylated IRF3 and these downstream effectors was observed in the HeLa cells, thus establishing the involvement of cGAS and TLR3 in the RNA–DNA hybrid-triggered innate immune response. To further study the effect of the RNA–DNA hybrids in innate immune cells, Rigby and coworkers synthesized a 60-basepair RNA–DNA hybrid and transfected it into isolated and cultured dendritic cells [101]. Their experiments demonstrated that TLR9 selectively binds to the nucleic acid hybrid, thereby causing IRF3-mediated activation of type I interferons and boosting the secretion of cytokines such as IL-6 and IFN-α3. Finally, Boros-Oláh and coworkers considered the R-loop-forming genes as drug targets for cancer therapy [102]. In silico analysis by this group used The Cancer Genome Atlas (TCGA) to study 33 primary cancer types. To investigate the correlation between R-loop gene expression and survival rate among cancer patients, the authors used data from TCGA to generate Kaplan–Meier survival curves. In 70% of cases, low expression of R-loop genes, such asRNASEH2A,THOC6,PRMT1, andP1F1, was observed to be associated with prolonged survival of cancer patients with mesothelioma and a low expression ofFANCMwas linked to prolonged survival among breast cancer patients. However, in 30% of cases, high expression of R-loop genes, such asTREX1andBUB3, was associated with prolonged survival of patients with cervical squamous cell carcinoma and endocervical adenocarcinoma. For ten R-loop genes (ATXN2,BRCA2,CARM1,DDX19A,RNASEH1,THOC2,THOC3,TOP1,U2AF1, andZNF207), long-term survival was observed only in the low-expressing group of patients. This study also reported an 80% association between the expression levels of R-loop genes in cancer cell lines and their sensitivity to chemotherapeutics approved by the US Food and Drug Administration (FDA). However, they also observed significant variability in drug interactions; for example, lung small cell carcinoma and ovarian cancer cells were sensitive to most of the drugs, however, B-cell leukemia, Hodgkin’s lymphoma, head, and neck cancer, and Ewing sarcoma cells were less susceptible to the FDA-approved chemotherapeutics. ## 7. Successes, Adverse Events, and Efforts to Avoid Them The current “standard of care” involves mainly strategies of direct attack and killing of cancer cells in a tumor. In this strategy, the mutating cancer cells often develop chemoresistance, however, the chemotherapy-mediated killing of fast-dividing immune cells precipitates unwanted infections. Additionally, immunotherapy, currently used for many types of cancer, sometimes causes autoimmune attacks. A comprehensive analysis of immune checkpoint inhibitor therapy of 4489 patients with primary melanoma and a median age of 74.9 was recently reported. This study also had a follow-up survey, in which 1575 patients displayed immune-related adverse events (AE) [11]. Other AEs result from inhibiting an array of diverse signaling pathways, summarized elegantly in a few reviews [103,104]. As for successes, a report published by Merck for the PD-1 antibody drug Keytruda (pembrolizumab) in non-small cell lung carcinoma (NSCLC) showed an overall five-year survival (OS) rate of 23% in treatment-naïve patients (n = 101) and 15.5% OS in patients receiving prior treatment (n = 449). Among patients with PD-L1-expressing tumors, the OS was higher at 29% (n = 27) and 25% (n = 138), respectively [105]. As mentioned earlier, among the immune checkpoint inhibitors, several PD-1 antibodies, some CTLA-4 antibodies, and some PD-L1 antibodies have been used in clinical trials. Among these agents, atezolizumab, a PD-L1 inhibitor, appeared to have the best safety profile [106]. However, some patients treated with atezolizumab experienced chills, pyrexia, and flushing, possibly due to the activation of innate immunity by the intact human Fc region in this antibody. These relatively mild AEs were managed with paracetamol, antihistamine, and steroids only when required. ## 8. Summary and Concluding Remarks In this review, we have attempted to give an overview of cancer therapy strategies at the preclinical and clinical levels, which mainly involve the innate and adaptive immune systems. First, we cite the work of Afshar-Sterle and coworkers showing that although deregulated expression of theBCL6oncogene is observed in many B-cell lymphoma patients, deliberate overexpression of this gene in mice does not cause lymphoma unless CD28- and Fas-ligand activities are simultaneously impaired in CD8+ Tc cells [5]. We also cited the work of Shi and coworkers;knl1-deletion-mediated DNA damage concomitantly triggers apoptosis and phagocytosis of neural progenitor cells by microglia [6]. Therefore, synchronous involvement of both innate and adaptive immune cells protects an organism from DNA mutation-evoked cancer. We have also discussed some promising strategies involving immunotherapy involving the empowerment of Tc cells and the difficulties experienced in the clinic with immunotherapy. Cognizant of the promise of using innate immune cells such as activated dendritic cells and NK cells in cancer therapy, several preclinical studies have been conducted, revealing that in the presence of pathogens, the dendritic cells secrete IFN1, which causes the activation of CD8+ Tc cells [61,62,63]. We have also discussed strategies to eliminate the tumor-promoting M2 macrophages and repolarizing them into the tumoricidal M1 phenotype. The first group of studies revealed that the inhibition of the (CSF-1)/CSF-1R pathway, which triggers TAM recruitment into tumor and M2-polarization of the recruits, only pushes the TAMs to the M1-like phenotype, which also causes CD8+ Tc cell activation [80,81,82]. A few relatively new methods of TAM repolarization were also discussed, using the cGAS-STING axis and the TLR3 agonist poly-ICLC [84,85,86,87,88,89]. In our preclinical studies of both GBM and peripheral cancers, we have noticed a profound role of TAMs in initiating a cascade of events involving activated NKp46+ NK cells and CD68+ Tc cells [15,19,20,23]. Thus, it can be concluded that the innate and adaptive immune systems work in close coordination. This notion must be front and center in designing safer and more effective cancer therapy strategies. We have argued that, in contrast to many synthetic CAs that completely shut off a specific signaling axis, thus causing adverse side effects, the most beneficial dietary anticancer compounds are pleiotropic and do not completely shut off any particular pathway. However, recently, they have rarely been considered for clinical studies. Two such studies, conducted recently by Basak and coworkers and Tosevska and coworkers, used a turmeric-based drug, APG-157, in head and neck cancer patients and measured cf-RNA to note leukocyte activation and the upregulation of transcripts bearing an inflammatory response and also a reversal of cancer-driven dysbiosis of the oral microbiome [91,92]. It is perhaps understood from a large number of attempts to develop an effective strategy for difficult-to-treat cancers that we may need to divert our attention from designing molecules to directly kill the cancer cells to empowering the immune system as a whole so that patients regain the ability to eliminate the mutated cells quickly before they cause cancer. For years, epidemiological studies have shown a link between cancer and diet. Still, we have continued to synthesize new antimetabolites and drugs to selectively activate some specific immune cells without making a concerted effort to take lessons from our diet and lifestyle and apply them to empower the human body to eliminate such aberrant cells. It is time that we change our approach to conquer many deadly cancers, such as pancreatic cancer and GBM. ## Acknowledgments Figure 1andFigure 2were created with BioRender.com (accessed on 19 January 2023). ## Author Contributions Conceptualization, P.B. and K.K.; Writing—original draft, S.M., J.C., P.M., P.B. and K.K.; Review and Editing, P.B. and K.K.; Project Administration, P.B.; Funding Acquisition, P.B. and K.K. All authors have read and agreed to the published version of the manuscript. ## Institutional Review Board Statement Prior studies cited here from the PB-lab involved experiments in mice, which were conducted according to CSI IACUC-approved procedures. ## Informed Consent Statement This review did not involve any experiments conducted in humans. ## Data Availability Statement Data generated by the prior experiments have been published and cited in this review. Further details will be available upon request. ## Conflicts of Interest The authors declare no conflict of interest. ## Funding Statement P.B. is supported by grants from NCI (CA253069) and CUNY University Committee on Research Awards (PSC-CUNY 52). K.K. is supported in part by the National Institutes of Health (R01GM123508) and the Professional Staff Congress-City University of New York (PSC-CUNY) (TRADB-49-271). ## Footnotes ## References ## Associated Data This section collects any data citations, data availability statements, or supplementary materials included in this article. ### Data Availability Statement Data generated by the prior experiments have been published and cited in this review. Further details will be available upon request.	[ "Shubhasmita Mohapatra", "Jared Cafiero", "Khosrow Kashfi", "Parag Mehta", "Probal Banerjee" ]	International Journal of Molecular Sciences	10.3390/ijms24055026	36902456	2	2	1,808	40,746
PMC10002506	Plant Protection against Viruses: An Integrated Review of Plant Immunity Agents	"Plant viruses are an important class of pathogens that seriously affect plant growth and harm crop (...TRUNCATED)	"## 1. Introduction\n\nCurrently, most conventional pesticides are expected to comprehensively preve(...TRUNCATED)	[ "Min Huang", "Zilin Wu", "Jingxin Li", "Yuyu Ding", "Shilin Chen", "Xiangyang Li" ]	International Journal of Molecular Sciences	10.3390/ijms24054453	36901884	3	3	1,081	26,133
PMC10002644	Rolosense: Mechanical detection of SARS-CoV-2 using a DNA-based motor	"Assays detecting viral infections play a significant role in limiting the spread of diseases such a(...TRUNCATED)	"## Design principles of Rolosense platform\n\nWe first functionalized DNA-based motors and chips wi(...TRUNCATED)	["Selma Piranej","Luona Zhang","Alisina Bazrafshan","Mariana Marin","Gregory B Melikyan","Khalid Sal(...TRUNCATED)	bioRxiv	10.1101/2023.02.27.530294	36909543	6	6	1,186	41,272
PMC10003097	New advances in CRISPR/Cas-mediated precise gene-editing techniques	"Over the past decade, CRISPR/Cas-based gene editing has become a powerful tool for generating mutat(...TRUNCATED)	"## Introduction\n\nGene editing via CRISPR/Cas technology has become a key tool for researchers in (...TRUNCATED)	[ "Chris Richardson", "Robert N Kelsh", "Rebecca J Richardson" ]	Disease Models & Mechanisms	10.1242/dmm.049874	36847161	3	3	1,301	46,714
PMC10003248	The Landscape of Circular RNAs in Cardiovascular Diseases	"Cardiovascular disease (CVD) remains the leading cause of mortality globally. Circular RNAs (circRN(...TRUNCATED)	"## 1. Introduction\n\nThe incidence of cardiovascular disease (CVD) has been increasing rapidly in (...TRUNCATED)	[ "Qi Long", "Bingjie Lv", "Shijiu Jiang", "Jibin Lin" ]	International Journal of Molecular Sciences	10.3390/ijms24054571	36902000	2	2	557	33,996
PMC10003267	"Engineering of DNA Structures Attached to Magnetic Particles for Effective Trans- and Cis-Cleavage (...TRUNCATED)	"Sequence-specific endonuclease Cas12-based biosensors have rapidly evolved as a strong tool to dete(...TRUNCATED)	"## 1. Introduction\n\nCRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISP(...TRUNCATED)	[ "Aleksandr V Ivanov", "Irina V Safenkova", "Sergey F Biketov", "Anatoly V Zherdev", "Boris B Dzantiev" ]	International Journal of Molecular Sciences	10.3390/ijms24054484	36901914	5	5	1,518	39,207

End of preview. Expand in Data Studio

source_datasets: - PubMed Central

STXBP1 PubMed Central Full-Text Dataset v2

A comprehensive collection of 31,786 full-text scientific articles from PubMed Central related to STXBP1, synaptic function, and neurological research.

🆕 Version 2 Updates (December 2025)

Complete re-extraction with improved HTML parsing
Full main text with proper section headers
Enhanced metadata extraction
99.7% figure-image matching (see companion multimodal dataset)

Dataset Overview

Metric	Value
Total Articles	31,786
Articles with STXBP1 mentions	1,335
Articles with Munc18 mentions	1,200+
Articles with abstract: 30,856
Total Abstract Characters	~45 million
Articles with main_text: 31,684
Total Main Text Characters	~1.44 billion
Average Abstract Length	1,421 chars
Average Main Text Length	45,391 chars

Schema

Column	Type	Description
`pmc_id`	string	PubMed Central ID (e.g., "PMC10196665")
`title`	string	Article title
`abstract`	string	Article abstract
`main_text`	string	Full article text with section headers
`authors`	string	Author list
`journal`	string	Journal name
`doi`	string	Digital Object Identifier
`pmid`	string	PubMed ID
`publish_date`	string	Publication date
`stxbp1_mentions`	int	Count of STXBP1 mentions in text
`munc18_mentions`	int	Count of Munc18 mentions in text
`num_figures`	int	Number of figures in article
`num_images`	int	Number of matched figure images
`abstract_length`	int	Character count of abstract
`main_text_length`	int	Character count of main text

Usage

Load with Hugging Face Datasets

from datasets import load_dataset

dataset = load_dataset("SkyWhal3/stxbp1-pubmed-central-fulltext")

# Access the data
df = dataset['train'].to_pandas()

# Filter STXBP1-specific articles
stxbp1_articles = df[df['stxbp1_mentions'] > 0]
print(f"Found {len(stxbp1_articles)} STXBP1-related articles")

Load with Pandas

import pandas as pd

df = pd.read_parquet("hf://datasets/SkyWhal3/stxbp1-pubmed-central-fulltext/stxbp1_pubmed_articles.parquet")

Example Queries

# Find articles about specific topics
seizure_articles = df[df['main_text'].str.contains('seizure', case=False, na=False)]

# Get articles with most STXBP1 mentions
top_stxbp1 = df.nlargest(10, 'stxbp1_mentions')[['pmc_id', 'title', 'stxbp1_mentions']]

# Find articles by keyword in title
crispr_articles = df[df['title'].str.contains('CRISPR|gene therapy', case=False, na=False)]

Related Resources

Resource	Description	Link
Multimodal Dataset	Same articles + 170K figure images	SkyWhal3/STXBP1_PubMed_Central_Multimodal_Dataset
ClinVar Dataset	STXBP1 genetic variants	SkyWhal3/stxbp1-clinvar
Trained Model	Fine-tuned Qwen3-VL-8B	Coming soon!

About STXBP1

STXBP1 (Syntaxin-Binding Protein 1), also known as Munc18-1, is essential for synaptic vesicle fusion and neurotransmitter release. Mutations cause STXBP1 Encephalopathy, a rare neurological disorder characterized by:

Early-onset epilepsy
Developmental delays
Movement disorders
Intellectual disability

This dataset supports AI-powered research into understanding and treating STXBP1-related conditions.

Citation

@dataset{stxbp1_fulltext_2025,
  author = {SkyWhal3},
  title = {STXBP1 PubMed Central Full-Text Dataset},
  year = {2025},
  publisher = {Hugging Face},
  url = {https://huggingface.co/datasets/SkyWhal3/stxbp1-pubmed-central-fulltext}
}

License

CC-BY-4.0. Source articles are from PubMed Central's Open Access subset.

Changelog

v2.0 (December 2025)

Complete re-extraction with improved parsing
Added section headers to main_text
Enhanced metadata fields
Added figure/image counts
Added text length statistics

v1.0 (December 2025)

Initial release

This dataset is dedicated to all children and families affected by STXBP1 Encephalopathy.

Downloads last month: 19

Size of downloaded dataset files:

784 MB

Size of the auto-converted Parquet files:

784 MB

Number of rows:

31,786